Human DIABLO(Diablo Homolog) ELISA Kit

To Order: Contact

Human Diablo Homolog (DIABLO) ELISA Kit
RDR-DIABLO-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Diablo Homolog (DIABLO) ELISA Kit
RDR-DIABLO-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Diablo Homolog (DIABLO) ELISA Kit
RD-DIABLO-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Diablo Homolog (DIABLO) ELISA Kit
RD-DIABLO-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Diablo Homolog (DIABLO) ELISA Kit
20-abx151312	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Diablo Homolog (DIABLO) ELISA Kit
SEJ266Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Diablo Homolog (DIABLO) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Diablo Homolog (DIABLO) in Tissue homogenates, cell lysates and other biological fluids.

Human Diablo Homolog (DIABLO) ELISA Kit
SEJ266Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Diablo Homolog (DIABLO) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Diablo Homolog (DIABLO) in Tissue homogenates, cell lysates and other biological fluids.

Human Diablo Homolog (DIABLO) ELISA Kit
SEJ266Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Diablo Homolog (DIABLO) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Diablo Homolog (DIABLO) in Tissue homogenates, cell lysates and other biological fluids.

Human Diablo Homolog (DIABLO) ELISA Kit
SEJ266Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Diablo Homolog (DIABLO) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Diablo Homolog (DIABLO) in Tissue homogenates, cell lysates and other biological fluids.

Human Diablo Homolog (DIABLO) ELISA Kit
4-SEJ266Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Diablo Homolog elisa. Alternative names of the recognized antigen: SMAC DIABLO-S Direct IAP-binding protein with low pI Second mitochondria-derived activator of caspase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Diablo Homolog (DIABLO) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Diablo Homolog ELISA Kit (DIABLO)
RK03615	Abclonal	96 Tests	EUR 521

Rat Diablo Homolog (DIABLO) ELISA Kit
SEJ266Ra-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5124.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Diablo Homolog (DIABLO) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Diablo Homolog (DIABLO) in tissue homogenates, cell lysates and other biological fluids.

Rat Diablo Homolog (DIABLO) ELISA Kit
SEJ266Ra-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 509.64
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Diablo Homolog (DIABLO) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Diablo Homolog (DIABLO) in tissue homogenates, cell lysates and other biological fluids.

Rat Diablo Homolog (DIABLO) ELISA Kit
SEJ266Ra-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 685.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Diablo Homolog (DIABLO) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Diablo Homolog (DIABLO) in tissue homogenates, cell lysates and other biological fluids.

Rat Diablo Homolog (DIABLO) ELISA Kit
SEJ266Ra-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2783.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Diablo Homolog (DIABLO) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Diablo Homolog (DIABLO) in tissue homogenates, cell lysates and other biological fluids.

Rat Diablo Homolog (DIABLO) ELISA Kit
4-SEJ266Ra	Cloud-Clone	EUR 5175.00 EUR 2734.00 EUR 686.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Diablo Homolog elisa. Alternative names of the recognized antigen: SMAC DIABLO-S Direct IAP-binding protein with low pI Second mitochondria-derived activator of caspase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Diablo Homolog (DIABLO) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Diablo Homolog (DIABLO) Antibody
20-abx176157	Abbexa	EUR 1205.00 EUR 578.00	1 mg 200 ug
Please enquire.

Diablo Homolog (DIABLO) Antibody
20-abx176158	Abbexa	EUR 1302.00 EUR 620.00	1 mg 200 ug
Please enquire.

Diablo Homolog (DIABLO) Antibody
20-abx212475	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Diablo Homolog (DIABLO) Antibody
20-abx212504	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Diablo Homolog (DIABLO) Antibody
20-abx112053	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Diablo Homolog (DIABLO) Antibody
20-abx172105	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Diablo Homolog (DIABLO) Antibody
20-abx172106	Abbexa	EUR 913.00 EUR 467.00	1 mg 200 ug
Please enquire.

Diablo Homolog (DIABLO) Antibody
20-abx333841	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Human Diablo homolog, mitochondrial, DIABLO ELISA KIT
ELI-25841h	Lifescience Market	96 Tests	EUR 824

ELISA kit for Human DIABLO (Diablo Homolog)
ELK4816	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Diablo Homolog (DIABLO). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Diablo Hom Show more
Description: A sandwich ELISA kit for detection of Diablo Homolog from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Diablo Homolog (DIABLO) CLIA Kit
20-abx495657	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Diablo Homolog (DIABLO) Protein
20-abx653171	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

ELISA kit for Rat DIABLO (Diablo Homolog)
ELK7379	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Diablo Homolog (DIABLO). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Diablo Hom Show more
Description: A sandwich ELISA kit for detection of Diablo Homolog from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Mouse Diablo homolog, mitochondrial, Diablo ELISA KIT
ELI-48369m	Lifescience Market	96 Tests	EUR 865

Diablo Homolog (DIABLO) Antibody (HRP)
20-abx335325	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Diablo Homolog (DIABLO) Antibody (FITC)
20-abx335326	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Diablo Homolog (DIABLO) Antibody (Biotin)
20-abx335327	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Rat Diablo Homolog (DIABLO) Protein
20-abx653172	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Diablo homolog (DIABLO) polyclonal antibody
ABP-PAB-10267	Allele Biotech	100 ug	Ask for price
Product line: Apoptosis Brand:

ELISA kit for Human Diablo homolog, mitochondrial (DIABLO)
KTE62061-48T	Abbkine	48T	EUR 332
DIABLO encodes an inhibitor of apoptosis protein (IAP)-binding protein. The encoded mitochondrial protein enters the cytosol when cells undergo apoptosis, and allows activation of caspases by binding to inhibitor of apoptosis proteins. Overexpression Show more
Description: Quantitative sandwich ELISA for measuring Human Diablo homolog, mitochondrial (DIABLO) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Diablo homolog, mitochondrial (DIABLO)
KTE62061-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
DIABLO encodes an inhibitor of apoptosis protein (IAP)-binding protein. The encoded mitochondrial protein enters the cytosol when cells undergo apoptosis, and allows activation of caspases by binding to inhibitor of apoptosis proteins. Overexpression Show more
Description: Quantitative sandwich ELISA for measuring Human Diablo homolog, mitochondrial (DIABLO) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Diablo homolog, mitochondrial (DIABLO)
KTE62061-96T	Abbkine	96T	EUR 539
DIABLO encodes an inhibitor of apoptosis protein (IAP)-binding protein. The encoded mitochondrial protein enters the cytosol when cells undergo apoptosis, and allows activation of caspases by binding to inhibitor of apoptosis proteins. Overexpression Show more
Description: Quantitative sandwich ELISA for measuring Human Diablo homolog, mitochondrial (DIABLO) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Diablo homolog, mitochondrial (DIABLO)
KTE71285-48T	Abbkine	48T	EUR 332
DIABLO encodes an inhibitor of apoptosis protein (IAP)-binding protein. The encoded mitochondrial protein enters the cytosol when cells undergo apoptosis, and allows activation of caspases by binding to inhibitor of apoptosis proteins. Overexpression Show more
Description: Quantitative sandwich ELISA for measuring Mouse Diablo homolog, mitochondrial (DIABLO) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Diablo homolog, mitochondrial (DIABLO)
KTE71285-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
DIABLO encodes an inhibitor of apoptosis protein (IAP)-binding protein. The encoded mitochondrial protein enters the cytosol when cells undergo apoptosis, and allows activation of caspases by binding to inhibitor of apoptosis proteins. Overexpression Show more
Description: Quantitative sandwich ELISA for measuring Mouse Diablo homolog, mitochondrial (DIABLO) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Diablo homolog, mitochondrial (DIABLO)
KTE71285-96T	Abbkine	96T	EUR 539
DIABLO encodes an inhibitor of apoptosis protein (IAP)-binding protein. The encoded mitochondrial protein enters the cytosol when cells undergo apoptosis, and allows activation of caspases by binding to inhibitor of apoptosis proteins. Overexpression Show more
Description: Quantitative sandwich ELISA for measuring Mouse Diablo homolog, mitochondrial (DIABLO) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

DIABLO
E541-004	EnoGene	100ug	EUR 343

DIABLO ELISA KIT|Human
EF009108	Lifescience Market	96 Tests	EUR 689

DIABLO antibody
20R-1288	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal DIABLO antibody

Diablo antibody
20R-2899	Fitzgerald	100 ul	EUR 393
Description: Rabbit polyclonal Diablo antibody

DIABLO Antibody
31125-100ul	SAB	100ul	EUR 252

DIABLO Antibody
31125-50ul	SAB	50ul	EUR 187

DIABLO antibody
70R-16834	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal DIABLO antibody

DIABLO Antibody
32716-100ul	SAB	100ul	EUR 252

DIABLO Antibody
48991-100ul	SAB	100ul	EUR 333

DIABLO Antibody
48991-50ul	SAB	50ul	EUR 239

DIABLO Antibody
1-CSB-PA966330	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against DIABLO. Recognizes DIABLO from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:50-1:200

DIABLO Antibody
1-CSB-PA865113LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DIABLO. Recognizes DIABLO from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

DIABLO Antibody
DF7017	Affbiotech	200ul	EUR 304
Description: DIABLO Antibody detects endogenous levels of total DIABLO.

DIABLO Antibody
1-CSB-PA592293	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against DIABLO. Recognizes DIABLO from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:100-1:300

DIABLO Antibody
1-CSB-PA006888GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against DIABLO. Recognizes DIABLO from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

DIABLO antibody
70R-DR008	Fitzgerald	100 ug	EUR 300
Description: Affinity purified Rabbit polyclonal DIABLO antibody

DIABLO siRNA
20-abx914146	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

DIABLO siRNA
20-abx914147	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

DIABLO Antibody
ABD7017	Lifescience Market	100 ug	EUR 438

anti-DIABLO
YF-PA27589	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to DIABLO

Human Diablo/SMAC ELISA Kit
LF-EK50928	Abfrontier	1×96T	EUR 648

DIABLO ELISA Kit (Human) (OKCD09174)
OKCD09174	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: This gene encodes an inhibitor of apoptosis protein (IAP)-binding protein. The encoded mitochondrial protein enters the cytosol when cells undergo apoptosis, and allows activation of caspases by binding to inhibitor of apoptosis proteins. Overexpression of the encoded protein sensitizes tumor cells to apoptosis. A mutation in this gene is associated with young-adult onset of nonsyndromic deafness-64. Alternative splicing results in multiple transcript variants encoding different isoforms.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.056ng/mL

Human DIABLO Protein
abx060001-100ug	Abbexa	100 ug	EUR 328
Shipped within 5-10 working days.

Anserini Smac/DIABLO ELISA Kit
EAS0020	Abclonal	96Tests	EUR 521

DIABLO ELISA Kit (Rat) (OKCD04273)
OKCD04273	Aviva Systems Biology	96 Wells	EUR 936
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.063 ng/mL

ELISA kit for Human Diablo/SMAC
EK5376	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Diablo/SMAC in samples from serum, plasma, tissue homogenates and other biological fluids.

Human Diablo/SMAC PicoKine ELISA Kit
EK0838	BosterBio	96 wells	EUR 425
Description: For quantitative detection of human Diablo in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Diablo/SMAC ELISA Kit (Human) (OKBB00448)
OKBB00448	Aviva Systems Biology	96 Wells	EUR 505
Description: Description of target: Diablo homolog, mitochondrial, also known as second mitochondria-derived activator of caspases (SMAC), is a protein that in humans is encoded by the DIABLO gene (direct IAP binding protein with low pI). It is mapped to 12q24.31. DIABLO can bind mammalian IAP homolog A (MIHA, or API3) and can also interact with MIHB, MIHC, and OpIAP, the baculoviral IAP. This gene encodes an inhibitor of apoptosis protein (IAP)-binding protein. The encoded mitochondrial protein enters the cytosol when cells undergo apoptosis, and allows activation of caspases by binding to inhibitor of apoptosis proteins. Over expression of the encoded protein sensitizes tumor cells to apoptosis. A mutation in this gene is associated with young-adult onset of nonsyndromic deafness-64.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: <= 10 pg/mL

DIABLO Rabbit pAb
A0853-100ul	Abclonal	100 ul	EUR 308

DIABLO Rabbit pAb
A0853-200ul	Abclonal	200 ul	EUR 459

DIABLO Rabbit pAb
A0853-20ul	Abclonal	20 ul	Ask for price

DIABLO Rabbit pAb
A0853-50ul	Abclonal	50 ul	Ask for price

DIABLO Rabbit pAb
A13432-100ul	Abclonal	100 ul	EUR 308

DIABLO Rabbit pAb
A13432-200ul	Abclonal	200 ul	EUR 459

DIABLO Rabbit pAb
A13432-20ul	Abclonal	20 ul	EUR 183

DIABLO Rabbit pAb
A13432-50ul	Abclonal	50 ul	EUR 223

DIABLO Blocking Peptide
33R-5520	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DIABLO antibody, catalog no. 20R-1288

Smac/DIABLO Antibody
3298-100	Biovision		EUR 316

Smac/DIABLO Antibody
3298-30T	Biovision		EUR 146

Smac/DIABLO Antibody
39330-100ul	SAB	100ul	EUR 390

DIABLO Blocking Peptide
DF7017-BP	Affbiotech	1mg	EUR 195

Smac / DIABLO Antibody
abx037649-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

SMAC / DIABLO Antibody
20-abx137470	Abbexa	EUR 704.00 EUR 328.00 EUR 230.00	100 ug 20 ug 5 ug
Shipped within 5-10 working days.

SMAC / DIABLO Protein
20-abx262000	Abbexa	EUR 4490.00 EUR 328.00 EUR 230.00	1 mg 20 ug 5 ug
Shipped within 5-10 working days.

DIABLO Conjugated Antibody
C48991	SAB	100ul	EUR 397

DIABLO Conjugated Antibody
C32716	SAB	100ul	EUR 397

DIABLO Conjugated Antibody
C31125	SAB	100ul	EUR 397

DIABLO cloning plasmid
CSB-CL865113HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 720 Sequence: atggcggctctgaagagttggctgtcgcgcagcgtaacttcattcttcaggtacagacagtgtttgtgtgttcctgttgtggctaactttaagaagcggtgtttctcagaattgataagaccatggcacaaaactgtgacgattggctttggagtaaccctgtgtgcggttcctat Show more
Description: A cloning plasmid for the DIABLO gene.

DIABLO Rabbit pAb
A2564-100ul	Abclonal	100 ul	EUR 308

DIABLO Rabbit pAb
A2564-200ul	Abclonal	200 ul	EUR 459

DIABLO Rabbit pAb
A2564-20ul	Abclonal	20 ul	EUR 183

DIABLO Rabbit pAb
A2564-50ul	Abclonal	50 ul	EUR 223

anti- DIABLO antibody
FNab02384	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500-1:2000 IP: 1:500-1:1000 IHC: 1:20-1:200 Immunogen: diablo homolog(Drosophila) Uniprot ID: Q9NR28 Gene ID: 56616 Research Area: Cancer
Description: Antibody raised against DIABLO

anti-Smac/Diablo
LF-PA0045	Abfrontier	100 ul	EUR 334
Description: Rabbit polyclonal to Smac/Diablo

Anti-DIABLO antibody
PAab02384	Lifescience Market	100 ug	EUR 355

Anti-DIABLO antibody
STJ111037	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes an inhibitor of apoptosis protein (IAP)-binding protein. The encoded mitochondrial protein enters the cytosol when cells undergo apoptosis, and allows activation of caspases by binding to inhibitor of apoptosis proteins. Overexpression of the encoded protein sensitizes tumor cells to apoptosis. A mutation in this gene is associated with young-adult onset of nonsyndromic deafness-64. Alternative splicing results in multiple transcript variants encoding different isoforms.

Anti-DIABLO antibody
STJ115393	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes an inhibitor of apoptosis protein (IAP)-binding protein. The encoded mitochondrial protein enters the cytosol when cells undergo apoptosis, and allows activation of caspases by binding to inhibitor of apoptosis proteins. Overexpression of the encoded protein sensitizes tumor cells to apoptosis. A mutation in this gene is associated with young-adult onset of nonsyndromic deafness-64. Alternative splicing results in multiple transcript variants encoding different isoforms.

Anti-DIABLO antibody
STJ23380	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes an inhibitor of apoptosis protein (IAP)-binding protein. The encoded mitochondrial protein enters the cytosol when cells undergo apoptosis, and allows activation of caspases by binding to inhibitor of apoptosis proteins. Overexpression of the encoded protein sensitizes tumor cells to apoptosis. A mutation in this gene is associated with young-adult onset of nonsyndromic deafness-64. Alternative splicing results in multiple transcript variants encoding different isoforms.

anti-Smac / Diablo
YF-PA20009	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to Smac / Diablo

anti-Smac / Diablo
YF-PA20010	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to Smac / Diablo

Recombinant Human SMAC/DIABLO
7-06409	CHI Scientific	5µg	Ask for price

Recombinant Human SMAC/DIABLO
7-06410	CHI Scientific	20µg	Ask for price

Recombinant Human SMAC/DIABLO
7-06411	CHI Scientific	1mg	Ask for price

Human DIABLO shRNA Plasmid
20-abx961151	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

DIABLO Recombinant Protein (Human)
RP009337	ABM	100 ug	Ask for price

Smac/DIABLO Blocking Peptide
3298BP-50	Biovision		EUR 153

DIABLO Antibody, HRP conjugated
1-CSB-PA865113LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DIABLO. Recognizes DIABLO from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

DIABLO Antibody, FITC conjugated
1-CSB-PA865113LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DIABLO. Recognizes DIABLO from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

DIABLO Antibody, Biotin conjugated
1-CSB-PA865113LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DIABLO. Recognizes DIABLO from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Polyclonal Smac/DIABLO Antibody
APR00062G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Smac/DIABLO . This antibody is tested and proven to work in the following applications:

Anti-Smac/Diablo Antibody
A03790	BosterBio	100uL	EUR 432
Description: Rabbit Polyclonal Smac/Diablo Antibody. Validated in IP, WB and tested in Human.

Mouse DIABLO shRNA Plasmid
20-abx975688	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Anti-Smac/Diablo Antibody
PB9860	BosterBio	100ug/vial	EUR 334

DIABLO Recombinant Protein (Rat)
RP198050	ABM	100 ug	Ask for price

DIABLO Recombinant Protein (Mouse)
RP129032	ABM	100 ug	Ask for price

Anti-Smac / Diablo (4F9)
YF-MA18960	Abfrontier	50 ug	EUR 363
Description: Mouse monoclonal to Smac / Diablo

Anti-Smac / Diablo (4F9)
YF-MA18961	Abfrontier	200 ul	EUR 363
Description: Mouse monoclonal to Smac / Diablo

DIABLO ORF Vector (Human) (pORF)
ORF003113	ABM	1.0 ug DNA	EUR 95

SMAC/DIABLO Human Recombinant Protein
PROTQ9NR28	BosterBio	Regular: 20ug	EUR 317
Description: Smac/Diablo Human Recombinant fused to N-terminal T7-Tag produced in E.Coli is a single, non-glycosylated polypeptide chain containing 199 amino acids and having a molecular mass of 22 kDa.

DIABLO sgRNA CRISPR Lentivector set (Human)
K0601901	ABM	3 x 1.0 ug	EUR 339

SMAC/Diablo protein (T7 tag)
80R-1058	Fitzgerald	100 ug	EUR 397
Description: Purified recombinant Human SMAC/Diablo protein (T7 tag)

Smac/Diablo recombinant monoclonal antibody
A5554	Bimake	100ul X 3	EUR 595
Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however, Show more
Description: A recombinant monoclonal antibody from rabbit against human Smac/Diablo for WB, IHC,ELISA

Diablo ORF Vector (Rat) (pORF)
ORF066018	ABM	1.0 ug DNA	EUR 506

Diablo ORF Vector (Mouse) (pORF)
ORF043012	ABM	1.0 ug DNA	EUR 506

DIABLO sgRNA CRISPR Lentivector (Human) (Target 1)
K0601902	ABM	1.0 ug DNA	EUR 154

DIABLO sgRNA CRISPR Lentivector (Human) (Target 2)
K0601903	ABM	1.0 ug DNA	EUR 154

DIABLO sgRNA CRISPR Lentivector (Human) (Target 3)
K0601904	ABM	1.0 ug DNA	EUR 154

DIABLO Protein Vector (Human) (pPB-C-His)
PV012449	ABM	500 ng	EUR 329

DIABLO Protein Vector (Human) (pPB-N-His)
PV012450	ABM	500 ng	EUR 329

DIABLO Protein Vector (Human) (pPM-C-HA)
PV012451	ABM	500 ng	EUR 329

DIABLO Protein Vector (Human) (pPM-C-His)
PV012452	ABM	500 ng	EUR 329

Human DIABLO(Diablo Homolog) ELISA Kit