Human RLBP1(Retinaldehyde Binding Protein 1) ELISA Kit

To Order: Contact

Human Retinaldehyde Binding Protein 1 (RLBP1) ELISA Kit
SEC776Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Retinaldehyde Binding Protein 1 (RLBP1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Ass Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Retinaldehyde Binding Protein 1 (RLBP1) in Tissue homogenates, cell lysates and other biological fluids.

Human Retinaldehyde Binding Protein 1 (RLBP1) ELISA Kit
SEC776Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Retinaldehyde Binding Protein 1 (RLBP1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Ass Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Retinaldehyde Binding Protein 1 (RLBP1) in Tissue homogenates, cell lysates and other biological fluids.

Human Retinaldehyde Binding Protein 1 (RLBP1) ELISA Kit
SEC776Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Retinaldehyde Binding Protein 1 (RLBP1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Ass Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Retinaldehyde Binding Protein 1 (RLBP1) in Tissue homogenates, cell lysates and other biological fluids.

Human Retinaldehyde Binding Protein 1 (RLBP1) ELISA Kit
4-SEC776Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Retinaldehyde Binding Protein 1 elisa. Alternative names of the recognized antigen: CRALBP Cellular retinaldehyde-binding protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Retinaldehyde Binding Protein 1 (RLBP1) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Retinaldehyde Binding Protein 1 (RLBP1) Protein
20-abx166052	Abbexa	EUR 662.00 EUR 272.00 EUR 2040.00 EUR 787.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Retinaldehyde Binding Protein 1 (RLBP1) Antibody
20-abx115142	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Retinaldehyde-Binding Protein 1 (RLBP1) Antibody
20-abx123658	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Retinaldehyde Binding Protein 1 (RLBP1) Antibody
20-abx128205	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Retinaldehyde-Binding Protein 1 (RLBP1) Antibody
abx145086-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Retinaldehyde Binding Protein 1 (RLBP1) Antibody
20-abx174386	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Retinaldehyde-Binding Protein 1 (RLBP1) Antibody
abx237318-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Retinaldehyde Binding Protein 1 (RLBP1) Antibody
20-abx333900	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Recombinant Retinaldehyde Binding Protein 1 (RLBP1)
4-RPC776Hu01	Cloud-Clone	EUR 476.32 EUR 230.00 EUR 1511.20 EUR 570.40 EUR 1040.80 EUR 382.00 EUR 3628.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P12271 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 40.2kDa Isoelectric Point: Inquire
Description: Recombinant Human Retinaldehyde Binding Protein 1 expressed in: E.coli

Mouse Retinaldehyde-binding protein 1 (RLBP1) ELISA Kit
abx390444-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Bovine Retinaldehyde- binding protein 1, RLBP1 ELISA KIT
ELI-35778b	Lifescience Market	96 Tests	EUR 928

Mouse Retinaldehyde- binding protein 1, Rlbp1 ELISA KIT
ELI-41139m	Lifescience Market	96 Tests	EUR 865

Human Retinaldehyde-Binding Protein 1 (RLBP1) Antibody
32137-05111	AssayPro	150 ug	EUR 261

Human Retinaldehyde Binding Protein 1 (RLBP1) CLIA Kit
20-abx493896	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human RLBP1 (Retinaldehyde Binding Protein 1)
ELK5093	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Retinaldehyde Binding Protein 1 (RLBP1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specif Show more
Description: A sandwich ELISA kit for detection of Retinaldehyde Binding Protein 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Retinaldehyde-binding protein 1 (RLBP1)
KTE60792-48T	Abbkine	48T	EUR 354
Description: Quantitative sandwich ELISA for measuring Human Retinaldehyde-binding protein 1 (RLBP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Retinaldehyde-binding protein 1 (RLBP1)
KTE60792-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
Description: Quantitative sandwich ELISA for measuring Human Retinaldehyde-binding protein 1 (RLBP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Retinaldehyde-binding protein 1 (RLBP1)
KTE60792-96T	Abbkine	96T	EUR 572
Description: Quantitative sandwich ELISA for measuring Human Retinaldehyde-binding protein 1 (RLBP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

RLBP1 Retinaldehyde Binding Protein 1 Human Recombinant Protein
PROTP12271	BosterBio	Regular: 20ug	EUR 317
Description: RLBP1 Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 340 amino acids (1-317) and having a molecular mass of 38.9 kDa. RLBP1 is fused to a 23 amino acid His-tag at N-terminus.

Retinaldehyde Binding Protein 1 (RLBP1) Antibody (HRP)
20-abx337468	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Retinaldehyde Binding Protein 1 (RLBP1) Antibody (FITC)
20-abx337469	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Retinaldehyde Binding Protein 1 (RLBP1) Antibody (Biotin)
20-abx337470	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Rlbp1 ELISA Kit| Mouse Retinaldehyde-binding protein 1 ELISA Ki
EF016086	Lifescience Market	96 Tests	EUR 689

RLBP1 ELISA Kit| Bovine Retinaldehyde-binding protein 1 ELISA K
EF011856	Lifescience Market	96 Tests	EUR 689

Human Retinaldehyde-Binding Protein 1 (RLBP1) Antibody (Biotin Conjugate)
32137-05121	AssayPro	150 ug	EUR 369

Human Retinaldehyde-Binding Protein 1 (RLBP1) AssayLite Antibody (FITC Conjugate)
32137-05141	AssayPro	150 ug	EUR 428

Human Retinaldehyde-Binding Protein 1 (RLBP1) AssayLite Antibody (RPE Conjugate)
32137-05151	AssayPro	150 ug	EUR 428

Human Retinaldehyde-Binding Protein 1 (RLBP1) AssayLite Antibody (APC Conjugate)
32137-05161	AssayPro	150 ug	EUR 428

Human Retinaldehyde-Binding Protein 1 (RLBP1) AssayLite Antibody (PerCP Conjugate)
32137-05171	AssayPro	150 ug	EUR 471

Retinaldehyde Binding Protein 1 (RLBP1) Polyclonal Antibody (Human, Mouse, Pig)
4-PAC776Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RLBP1 (Met1~ Phe317) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Retinaldehyde Binding Protein 1 (RLBP1)

Retinaldehyde Binding Protein 1 (RLBP1) Polyclonal Antibody (Human, Mouse, Pig), APC
4-PAC776Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RLBP1 (Met1~ Phe317) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Retinaldehyde Binding Protein 1 (RLBP1). This antibody is labeled with APC.

Retinaldehyde Binding Protein 1 (RLBP1) Polyclonal Antibody (Human, Mouse, Pig), Biotinylated
4-PAC776Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RLBP1 (Met1~ Phe317) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Retinaldehyde Binding Protein 1 (RLBP1). This antibody is labeled with Biotin.

Retinaldehyde Binding Protein 1 (RLBP1) Polyclonal Antibody (Human, Mouse, Pig), Cy3
4-PAC776Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RLBP1 (Met1~ Phe317) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Retinaldehyde Binding Protein 1 (RLBP1). This antibody is labeled with Cy3.

Retinaldehyde Binding Protein 1 (RLBP1) Polyclonal Antibody (Human, Mouse, Pig), FITC
4-PAC776Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RLBP1 (Met1~ Phe317) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Retinaldehyde Binding Protein 1 (RLBP1). This antibody is labeled with FITC.

Retinaldehyde Binding Protein 1 (RLBP1) Polyclonal Antibody (Human, Mouse, Pig), HRP
4-PAC776Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RLBP1 (Met1~ Phe317) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Retinaldehyde Binding Protein 1 (RLBP1). This antibody is labeled with HRP.

Retinaldehyde Binding Protein 1 (RLBP1) Polyclonal Antibody (Human, Mouse, Pig), PE
4-PAC776Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RLBP1 (Met1~ Phe317) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Retinaldehyde Binding Protein 1 (RLBP1). This antibody is labeled with PE.

Retinaldehyde Binding Protein 1 (RLBP1) Polyclonal Antibody (Human, Mouse, Pig), APC-Cy7
4-PAC776Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RLBP1 (Met1~ Phe317) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Retinaldehyde Binding Protein 1 (RLBP1). This antibody is labeled with APC-Cy7.

Retinaldehyde Binding Protein 1 Protein
20-abx261256	Abbexa	EUR 3418.00 EUR 328.00 EUR 230.00	1 mg 20 ug 5 ug
Shipped within 5-10 working days.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Retinaldehyde Binding Protein 1-Like 2 Antibody
20-abx115143	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

RLBP1 ELISA KIT|Human
EF002485	Lifescience Market	96 Tests	EUR 689

RLBP1 ELISA Kit (Human) (OKCD00687)
OKCD00687	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: Soluble retinoid carrier essential the proper function of both rod and cone photoreceptors. Participates in the regeneration of active 11-cis-retinol and 11-cis-retinaldehyde, from the inactive 11-trans products of the rhodopsin photocycle and in the de novo synthesis of these retinoids from 11-trans metabolic precursors. The cycling of retinoids between photoreceptor and adjacent pigment epithelium cells is known as the 'visual cycle'.1 Publication <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.8"Bothnia dystrophy is caused by domino-like rearrangements in cellular retinaldehyde-binding protein mutant R234W."_x005F_x005F_x000D_He X., Lobsiger J., Stocker A._x005F_x005F_x000D_Proc. Natl. Acad. Sci. U.S.A. 106:18545-18550(2009) [PubMed] [Europe PMC] [Abstract]Cited for: X-RAY CRYSTALLOGRAPHY (1.69 ANGSTROMS) OF 2-317 OF WILD-TYPE AND MUTANT TRP-234 IN COMPLEX WITH 11-CIS-RETINAL, FUNCTION, TISSUE SPECIFICITY, RETINAL-BINDING SITES. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.54 ng/mL

RLBP1 Recombinant Protein (Human)
RP026491	ABM	100 ug	Ask for price

Human Retinol-Binding Protein (RBP) AssayMax ELISA Kit
ER1005-1	AssayPro	96 Well Plate	EUR 417

Human Retinol-Binding Protein (RBP) AssayMax ELISA Kit
ER2005-1	AssayPro	96 Well Plate	EUR 396

Human Complement C4-Binding Protein (C4BP) AssayMax ELISA Kit
EC2202-1	AssayPro	96 Well Plate	EUR 417

Human Retinol-Binding Protein 4 (RBP4) AssayMax ELISA Kit
ER3005-1	AssayPro	96 Well Plate	EUR 396

RLBP1 antibody
70R-19906	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal RLBP1 antibody

RLBP1 antibody
10R-5629	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal RLBP1 antibody

RLBP1 antibody
10R-5630	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal RLBP1 antibody

RLBP1 antibody
10R-5632	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal RLBP1 antibody

RLBP1 antibody
10R-7148	Fitzgerald	100 ul	EUR 726
Description: Mouse monoclonal RLBP1 antibody

RLBP1 Antibody
DF12466	Affbiotech	200ul	EUR 304
Description: RLBP1 antibody detects endogenous levels of RLBP1.

RLBP1 Antibody
1-CSB-PA019743GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RLBP1. Recognizes RLBP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

RLBP1 Antibody
1-CSB-PA019743LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RLBP1. Recognizes RLBP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

RLBP1 siRNA
20-abx931581	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RLBP1 siRNA
20-abx931582	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ULBP1 Human, UL16 Binding Protein 1 Human Recombinant Protein, Sf9
PROTQ9BZM6-1	BosterBio	Regular: 10ug	EUR 317
Description: ULBP1 Human Recombinant produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 200 amino acids (26-216) and having a molecular mass of 23.4kDa (Molecular size on SDS-PAGE will appear at approximately 20-40kDa).;ULBP1 is fused to a 6 amino acid IgG His-Tag at C-terminus and purified by proprietary chromatographic techniques.

Human Fatty Acid-Binding Protein 4 (FABP4) AssayMax ELISA Kit
EF2702-1	AssayPro	96 Well Plate	EUR 417

Human Fatty Acid-Binding Protein 5 (FABP5) AssayMax ELISA Kit
EF2705-1	AssayPro	96 Well Plate	EUR 417

FABP1 Fatty Acid Binding Protein-1 Human Recombinant Protein
PROTP07148-1	BosterBio	Regular: 10ug	EUR 317
Description: FABP1 Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 127 amino acids and having a total molecular mass of 14.2kDa (calculated).

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1	SBI	25 ul each	EUR 627
Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1	SBI	5 reactions	EUR 1152
Category: Stem Cell Products

RLBP1 protein (His tag)
80R-3655	Fitzgerald	100 ug	EUR 327
Description: Purified recombinant RLBP1 protein (His tag)

RLBP1 Recombinant Protein (Mouse)
RP168314	ABM	100 ug	Ask for price

RLBP1 Recombinant Protein (Mouse)
RP168317	ABM	100 ug	Ask for price

RLBP1 Recombinant Protein (Rat)
RP226190	ABM	100 ug	Ask for price

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

Human RLBP1 shRNA Plasmid
20-abx954083	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human Gc-Globulin (Vitamin D-binding Protein, DBP) AssayMax ELISA Kit
EG3801-1	AssayPro	96 Well Plate	EUR 396

Human Gc-Globulin (Vitamin D-binding Protein, DBP) AssayMax ELISA Kit
EG3811-1	AssayPro	96 Well Plate	EUR 417

Canine Retinol-Binding Protein 4 (RBP4) AssayMax ELISA Kit
ECR3005-1	AssayPro	96 Well Plate	EUR 396

Mouse Retinol-Binding Protein 4 (RBP4) AssayMax ELISA Kit
EMR3005-1	AssayPro	96 Well Plate	EUR 417

RLBP1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1826602	ABM	1.0 ug DNA	EUR 154

RLBP1 Polyclonal Antibody
31667-100ul	SAB	100ul	EUR 252

RLBP1 Polyclonal Antibody
31667-50ul	SAB	50ul	EUR 187

RLBP1 Blocking Peptide
DF12466-BP	Affbiotech	1mg	EUR 195

RLBP1 cloning plasmid
CSB-CL019743HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 954 Sequence: atgtcagaaggggtgggcacgttccgcatggtacctgaagaggaacaggagctccgtgcccaactggagcagctcacaaccaaggaccatggacctgtctttggcccgtgcagccagctgccccgccacaccttgcagaaggccaaggatgagctgaacgagagagaggagacccg Show more
Description: A cloning plasmid for the RLBP1 gene.

RLBP1 Rabbit pAb
A9094-100ul	Abclonal	100 ul	EUR 308

RLBP1 Rabbit pAb
A9094-200ul	Abclonal	200 ul	EUR 459

RLBP1 Rabbit pAb
A9094-20ul	Abclonal	20 ul	EUR 183

RLBP1 Rabbit pAb
A9094-50ul	Abclonal	50 ul	EUR 223

anti- RLBP1 antibody
FNab07318	FN Test	100µg	EUR 548.75
Immunogen: retinaldehyde binding protein 1 Uniprot ID: P12271 Gene ID: 6017 Research Area: Neuroscience
Description: Antibody raised against RLBP1

Anti-RLBP1 antibody
PAab07318	Lifescience Market	100 ug	EUR 386

Anti-RLBP1 antibody
STJ111562	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a 36-kD water-soluble protein which carries 11-cis-retinaldehyde or 11-cis-retinal as physiologic ligands. It may be a functional component of the visual cycle. Mutations of this gene have been associated with severe rod-cone dystrophy, Bothnia dystrophy (nonsyndromic autosomal recessive retinitis pigmentosa) and retinitis punctata albescens.

AZGP1 Alpha-2-Glycoprotein 1 Zinc-Binding Human Recombinant Protein
PROTP25311-1	BosterBio	Regular: 20ug	EUR 317
Description: AZGP1 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 301 amino acids (21-298 a.a) and having a molecular mass of 34.5kDa.;AZGP1 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

TARDBP (1-414) Human, TAR DNA Binding Protein (1-414 a.a.) Human Recombinant Protein, His Tag
PROTQ13148-1	BosterBio	Regular: 20ug	EUR 317
Description: TARDBP Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 450 amino acids (1-414 a.a) and having a total molecular mass of 48.8 kDa. TARDBP is fused to a 36 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

Human TANK-binding kinase 1-binding protein 1 (TBKBP1) ELISA Kit
abx385467-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human KRAB-associated Protein 1 (KAP-1) AssayMax ELISA Kit
EK2802-1	AssayPro	96 Well Plate	EUR 477

Human Calcineurin Binding Protein 1 ELISA kit
E01C0536-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Calcineurin Binding Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Calcineurin Binding Protein 1 ELISA kit
E01C0536-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Calcineurin Binding Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Calcineurin Binding Protein 1 ELISA kit
E01C0536-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Calcineurin Binding Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human GATA Binding Protein 1 ELISA kit
E01G0084-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human GATA Binding Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human GATA Binding Protein 1 ELISA kit
E01G0084-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human GATA Binding Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human GATA Binding Protein 1 ELISA kit
E01G0084-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human GATA Binding Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human UL16 Binding protein 1 ELISA kit
E01U0022-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human UL16 Binding protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human UL16 Binding protein 1 ELISA kit
E01U0022-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human UL16 Binding protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human UL16 Binding protein 1 ELISA kit
E01U0022-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human UL16 Binding protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Hyaluronan Binding Protein 1 ELISA kit
E01H0035-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Hyaluronan Binding Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Hyaluronan Binding Protein 1 ELISA kit
E01H0035-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Hyaluronan Binding Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Hyaluronan Binding Protein 1 ELISA kit
E01H0035-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Hyaluronan Binding Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

RLBP1 ORF Vector (Human) (pORF)
ORF008831	ABM	1.0 ug DNA	EUR 95

RLBP1 Protein Vector (Human) (pPB-C-His)
PV035321	ABM	500 ng	EUR 329

RLBP1 Protein Vector (Human) (pPB-N-His)
PV035322	ABM	500 ng	EUR 329

RLBP1 Protein Vector (Human) (pPM-C-HA)
PV035323	ABM	500 ng	EUR 329

RLBP1 Protein Vector (Human) (pPM-C-His)
PV035324	ABM	500 ng	EUR 329

Recombinant Human RLBP1 Protein, His, E.coli-10ug
QP13321-HIS-10ug	EnQuireBio	10ug	EUR 201

Recombinant Human RLBP1 Protein, His, E.coli-20ug
QP13321-HIS-20ug	EnQuireBio	20ug	EUR 201

Recombinant Human RLBP1 Protein, His, E.coli-2ug
QP13321-HIS-2ug	EnQuireBio	2ug	EUR 155

Recombinant Human RLBP1 Protein, His, E.coli-5ug
QP13321-HIS-5ug	EnQuireBio	5ug	EUR 155

Recombinant Human RLBP1 Protein, His, E.coli-1mg
QP13321-HIS-EC-1mg	EnQuireBio	1mg	EUR 2757

Recombinant Human RLBP1 Protein, His, Insect-1mg
QP13321-HIS-INSECT-1mg	EnQuireBio	1mg	EUR 5251

ULBP4 UL16 Binding Protein 4 Human Recombinant Protein
PROTQ8TD07-1	BosterBio	Regular: 10ug	EUR 317
Description: ULBP4 Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain (Isoform 3 of Q8TD07) containing 192 amino acids including a 10 aa His tag at N-terminus. The total calculated molecular mass is 22kDa.

AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-1	CORNING	1/pk	EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Human Heat Shock Factor Protein 1 (HSF 1) AssayMax ELISA kit
EH5215-1	AssayPro	96 Well Plate	EUR 417

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

ULBP2 Human, UL16 Binding Protein 2 Human Recombinant Protein, Sf9
PROTQ9BZM5-1	BosterBio	Regular: 10ug	EUR 317
Description: ULBP2 Human Recombinant produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 200 amino acids (26-216a.a) and having a molecular mass of 22.7kDa (Molecular size on SDS-PAGE will appear at approximately 28-40kDa). ULBP2 is fused to a 9 amino acid His-tag at C-terminus & purified by proprietary chromatographic techniques.

IL18BP Human, Interleukin-18 Binding Protein Human Recombinant Protein, Sf9
PROTO95998-1	BosterBio	Regular: 10ug	EUR 317
Description: IL18BP Human Recombinant produced in Sf9 Baculovirus cells is a single, non-glycosylated polypeptide chain containing 406 amino acids (31-194a.a) and having a molecular mass of 44.9kDa. (Molecular size on SDS-PAGE will appear at approximately 40-57kDa). IL18BP is fused to a 239 amino acid hIgG-His-tag at C-terminus & purified by proprietary chromatographic techniques.

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Human Hexokinase-1 AssayMax ELISA Kit
EH3101-1	AssayPro	96 Well Plate	EUR 477

Human Complexin-1 AssayMax ELISA Kit
EC3505-1	AssayPro	96 Well Plate	EUR 417

Human Glutaredoxin-1 AssayMax ELISA Kit
EG2153-1	AssayPro	96 Well Plate	EUR 417

S100b S100 Calcium Binding Protein B Human Recombinant Protein
PROTP04271-1	BosterBio	Regular: 20ug	EUR 317
Description: S100b Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 92 amino acids (1-92 a.a.) and having a molecular mass of 10.7kDa.; The S100b is purified by proprietary chromatographic techniques.

S100A8 S100 Calcium Binding Protein A8 Human Recombinant Protein
PROTP05109-1	BosterBio	Regular: 20ug	EUR 317
Description: S100A8 Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 93 amino acids (1-93 a.a.) and having a molecular mass of 10.8 kDa. The S100A8 is purified by proprietary chromatographic techniques.

FABP2 Fatty Acid Binding Protein-2 Human Recombinant Protein
PROTP12104-1	BosterBio	Regular: 25ug	EUR 317
Description: FABP2 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 131 amino acids and having a molecular mass of 15.1kDa.;The FABP2 is purified by proprietary chromatographic techniques.

Mouse RLBP1 shRNA Plasmid
20-abx972464	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

RLBP1 Polyclonal Conjugated Antibody
C31667	SAB	100ul	EUR 397

RLBP1 Antibody, HRP conjugated
1-CSB-PA019743LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RLBP1. Recognizes RLBP1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RLBP1 Antibody, FITC conjugated
1-CSB-PA019743LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RLBP1. Recognizes RLBP1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RLBP1 Antibody, Biotin conjugated
1-CSB-PA019743LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RLBP1. Recognizes RLBP1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

Human RalA Binding Protein 1 (RALBP1)ELISA Kit
201-12-2410	SunredBio	96 tests	EUR 440
This RalA Binding Protein 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human AE Binding Protein 1 (AEBP1)ELISA Kit
201-12-2821	SunredBio	96 tests	EUR 440
This AE Binding Protein 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human AE Binding Protein 1 (AEBP1) ELISA Kit
DLR-AEBP1-Hu-48T	DL Develop	48T	EUR 517
Should the Human AE Binding Protein 1 (AEBP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human AE Binding Protein 1 (AEBP1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human AE Binding Protein 1 (AEBP1) ELISA Kit
DLR-AEBP1-Hu-96T	DL Develop	96T	EUR 673
Should the Human AE Binding Protein 1 (AEBP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human AE Binding Protein 1 (AEBP1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Phosphatidylethanolamine Binding Protein 1 (PEBP1) ELISA Kit
DLR-PEBP1-Hu-48T	DL Develop	48T	EUR 517
Should the Human Phosphatidylethanolamine Binding Protein 1 (PEBP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Phosphatidylethanolamine Binding Protein 1 (PEBP1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Phosphatidylethanolamine Binding Protein 1 (PEBP1) ELISA Kit
DLR-PEBP1-Hu-96T	DL Develop	96T	EUR 673
Should the Human Phosphatidylethanolamine Binding Protein 1 (PEBP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Phosphatidylethanolamine Binding Protein 1 (PEBP1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human RalA Binding Protein 1 (RALBP1) ELISA Kit
DLR-RALBP1-Hu-48T	DL Develop	48T	EUR 517
Should the Human RalA Binding Protein 1 (RALBP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human RalA Binding Protein 1 (RALBP1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human RalA Binding Protein 1 (RALBP1) ELISA Kit
DLR-RALBP1-Hu-96T	DL Develop	96T	EUR 673
Should the Human RalA Binding Protein 1 (RALBP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human RalA Binding Protein 1 (RALBP1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Selenium Binding Protein 1 (SELENBP1) ELISA Kit
DLR-SELENBP1-Hu-48T	DL Develop	48T	EUR 517
Should the Human Selenium Binding Protein 1 (SELENBP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Selenium Binding Protein 1 (SELENBP1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Selenium Binding Protein 1 (SELENBP1) ELISA Kit
DLR-SELENBP1-Hu-96T	DL Develop	96T	EUR 673
Should the Human Selenium Binding Protein 1 (SELENBP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Selenium Binding Protein 1 (SELENBP1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Formin Binding Protein 1 (FNBP1) ELISA Kit
DLR-FNBP1-Hu-48T	DL Develop	48T	EUR 517
Should the Human Formin Binding Protein 1 (FNBP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Formin Binding Protein 1 (FNBP1) in samples from tissue homogenates or other biological fluids.

Human Formin Binding Protein 1 (FNBP1) ELISA Kit
DLR-FNBP1-Hu-96T	DL Develop	96T	EUR 673
Should the Human Formin Binding Protein 1 (FNBP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Formin Binding Protein 1 (FNBP1) in samples from tissue homogenates or other biological fluids.

Human Hyaluronan Binding Protein 1 (HABP1) ELISA Kit
DLR-HABP1-Hu-48T	DL Develop	48T	EUR 479
Should the Human Hyaluronan Binding Protein 1 (HABP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Hyaluronan Binding Protein 1 (HABP1) in samples from serum, plasma or other biological fluids.

Human Hyaluronan Binding Protein 1 (HABP1) ELISA Kit
DLR-HABP1-Hu-96T	DL Develop	96T	EUR 621
Should the Human Hyaluronan Binding Protein 1 (HABP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Hyaluronan Binding Protein 1 (HABP1) in samples from serum, plasma or other biological fluids.

Human Phosphatidylethanolamine-binding protein 1(PEBP1) ELISA kit
CSB-EL017766HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Phosphatidylethanolamine-binding protein 1 (PEBP1) in samples from serum, plasma, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Phosphatidylethanolamine-binding protein 1(PEBP1) ELISA kit
1-CSB-EL017766HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Phosphatidylethanolamine-binding protein 1(PEBP1) in samples from serum, plasma, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human X Box Binding Protein 1 ELISA kit
E01X0002-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human X Box Binding Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human X Box Binding Protein 1 ELISA kit
E01X0002-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human X Box Binding Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human X Box Binding Protein 1 ELISA kit
E01X0002-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human X Box Binding Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Syntaxin binding protein 1(STXBP1) ELISA kit
E01S0420-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Syntaxin binding protein 1(STXBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Syntaxin binding protein 1(STXBP1) ELISA kit
E01S0420-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Syntaxin binding protein 1(STXBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Syntaxin binding protein 1(STXBP1) ELISA kit
E01S0420-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Syntaxin binding protein 1(STXBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Calcium binding protein 1(CABP1) ELISA kit
E01C1297-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Calcium binding protein 1(CABP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Calcium binding protein 1(CABP1) ELISA kit
E01C1297-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Calcium binding protein 1(CABP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Calcium binding protein 1(CABP1) ELISA kit
E01C1297-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Calcium binding protein 1(CABP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Actin binding LIM protein 1 ELISA kit
E01A0983-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Actin binding LIM protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Actin binding LIM protein 1 ELISA kit
E01A0983-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Actin binding LIM protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Actin binding LIM protein 1 ELISA kit
E01A0983-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Actin binding LIM protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Heme binding protein 1(HEBP1) ELISA kit
E01H1367-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Heme binding protein 1(HEBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Heme binding protein 1(HEBP1) ELISA kit
E01H1367-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Heme binding protein 1(HEBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Heme binding protein 1(HEBP1) ELISA kit
E01H1367-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Heme binding protein 1(HEBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human AE Binding Protein 1 (AEBP1) ELISA Kit
20-abx150582	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Immunoglobulin Binding Protein 1 (IGBP1) ELISA Kit
20-abx156788	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human RLBP1(Retinaldehyde Binding Protein 1) ELISA Kit