Human EDA2R(Ectodysplasin A2 Receptor) ELISA Kit

To Order: Contact

Human Ectodysplasin A2 Receptor (EDA2R) ELISA Kit

SED931Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ectodysplasin A2 Receptor (EDA2R) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ectodysplasin A2 Receptor (EDA2R) in Tissue homogenates, cell lysates and other biological fluids.

Human Ectodysplasin A2 Receptor (EDA2R) ELISA Kit

SED931Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ectodysplasin A2 Receptor (EDA2R) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ectodysplasin A2 Receptor (EDA2R) in Tissue homogenates, cell lysates and other biological fluids.

Human Ectodysplasin A2 Receptor (EDA2R) ELISA Kit

SED931Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ectodysplasin A2 Receptor (EDA2R) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ectodysplasin A2 Receptor (EDA2R) in Tissue homogenates, cell lysates and other biological fluids.

Human Ectodysplasin A2 Receptor (EDA2R) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Ectodysplasin A2 Receptor elisa. Alternative names of the recognized antigen: XEDAR
  • EDA-A2R
  • EDAA2R
  • TNFRSF27
  • X-linked ectodysplasin-A2 receptor
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Ectodysplasin A2 Receptor (EDA2R) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Ectodysplasin A2 Receptor (EDA2R) Antibody

  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Ectodysplasin A2 Receptor (EDA2R) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ectodysplasin A2 Receptor (EDA2R) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ectodysplasin A2 Receptor (EDA2R) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Ectodysplasin A2 Receptor (EDA2R) Antibody

abx030265-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Ectodysplasin A2 Receptor (EDA2R) Antibody

abx030265-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Ectodysplasin A2 Receptor (EDA2R) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ectodysplasin A2 Receptor (EDA2R) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Human Ectodysplasin A2 Receptor (EDA2R) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Mouse Ectodysplasin A2 Receptor (EDA2R) ELISA Kit

abx389133-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ectodysplasin A2 Receptor (EDA2R) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human EDA2R (Ectodysplasin A2 Receptor)

ELK5111 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Ectodysplasin A2 Receptor (EDA2R). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to
  • Show more
Description: A sandwich ELISA kit for detection of Ectodysplasin A2 Receptor from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

EDA2R Ectodysplasin A2 Receptor Human Recombinant Protein

PROTQ9HAV5 Regular: 20ug
EUR 317
Description: EDA2R Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 161 amino acids (1-138 a.a) and having a molecular mass of 17.7kDa.

EDA2R Human, Ectodysplasin A2 Receptor Human Recombinant Protein, Sf9

PROTQ9HAV5-1 Regular: 10ug
EUR 317
Description: EDA2R Human Recombinant produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 380 amino acids (1-138a.a.) and having a molecular mass of 42.5kDa (Molecular size on SDS-PAGE will appear at approximately 40-57kDa). EDA2R is expressed with a 242 amino acid hIgG-His tag at C-Terminus and purified by proprietary chromatographic techniques.

Recombinant Mouse Ectodysplasin A2 Receptor/EDA2R/TNFRSF27 (C-Fc)

CM43-10ug 10ug
EUR 126
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Recombinant Mouse Ectodysplasin A2 Receptor/EDA2R/TNFRSF27 (C-Fc)

CM43-1mg 1mg
EUR 1877
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Recombinant Mouse Ectodysplasin A2 Receptor/EDA2R/TNFRSF27 (C-Fc)

CM43-500ug 500ug
EUR 1328
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Recombinant Mouse Ectodysplasin A2 Receptor/EDA2R/TNFRSF27 (C-Fc)

CM43-50ug 50ug
EUR 232
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Recombinant Mouse Ectodysplasin A2 Receptor/EDA2R/TNFRSF27 (C-6His)

CM44-10ug 10ug
EUR 126
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Recombinant Mouse Ectodysplasin A2 Receptor/EDA2R/TNFRSF27 (C-6His)

CM44-1mg 1mg
EUR 1877
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Recombinant Mouse Ectodysplasin A2 Receptor/EDA2R/TNFRSF27 (C-6His)

CM44-500ug 500ug
EUR 1328
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Recombinant Mouse Ectodysplasin A2 Receptor/EDA2R/TNFRSF27 (C-6His)

CM44-50ug 50ug
EUR 232
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Ectodysplasin A2 Receptor Protein

  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.


EF004889 96 Tests
EUR 689


ELI-51897h 96 Tests
EUR 824

Ectodysplasin A Receptor antibody

70R-7548 50 ug
EUR 467
Description: Rabbit polyclonal Ectodysplasin A Receptor antibody raised against the middle region of EDAR

EDA2R ELISA Kit (Human) (OKCD01792)

OKCD01792 96 Wells
EUR 831
Description: Description of target: Receptor for EDA isoform A2, but not for EDA isoform A1. Mediates the activation of the NF-kappa-B and JNK pathways. Activation seems to be mediated by binding to TRAF3 and TRAF6.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.056 ng/mL

Human Ectodysplasin-A ELISA kit

E01E0400-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Ectodysplasin-A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ectodysplasin-A ELISA kit

E01E0400-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Ectodysplasin-A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ectodysplasin-A ELISA kit

E01E0400-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Ectodysplasin-A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Eda2r ELISA KIT

ELI-45588m 96 Tests
EUR 865

Human Ectodysplasin A (EDA) ELISA Kit

abx251354-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

ELISA kit for Human Ectodysplasin-A

EK4144 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Ectodysplasin-A in samples from serum, plasma, tissue homogenates and other biological fluids.

Human EDA/ Ectodysplasin-A ELISA Kit

E0754Hu 1 Kit
EUR 571

Human EDA(Ectodysplasin-A) ELISA Kit

EH2028 96T
EUR 567.6
  • Detection range: 78-5000 pg/ml
  • Uniprot ID: Q92838
  • Alias: EDA(Ectodysplasin-A)/EDA protein homolog/Tabby protein/ED1/HED/EDA1/EDA2/HED1/ODT1/XHED/ECTD1/XLHED/ED1-A1/ED1-A2/EDA-A1/EDA-A2/STHAGX1/Ectodermal dysplasia protein
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml

Human Ectodysplasin- A, EDA ELISA KIT

ELI-06345h 96 Tests
EUR 824

Human Ectodysplasin A(EDA)ELISA Kit

QY-E01122 96T
EUR 400

Ectodysplasin A Receptor Blocking Peptide

33R-6971 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EDAR antibody, catalog no. 70R-7548

Ectodysplasin A Receptor (EDAR) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ectodysplasin A Receptor (EDAR) Antibody

abx232629-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Rat Ectodysplasin-A ELISA kit

E02E0400-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Ectodysplasin-A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Ectodysplasin-A ELISA kit

E02E0400-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Ectodysplasin-A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Ectodysplasin-A ELISA kit

E02E0400-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Ectodysplasin-A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Ectodysplasin-A ELISA kit

E03E0400-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Ectodysplasin-A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Ectodysplasin-A ELISA kit

E03E0400-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Ectodysplasin-A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Ectodysplasin-A ELISA kit

E03E0400-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Ectodysplasin-A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Ectodysplasin-A ELISA kit

E06E0400-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Ectodysplasin-A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Ectodysplasin-A ELISA kit

E06E0400-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Ectodysplasin-A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Ectodysplasin-A ELISA kit

E06E0400-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Ectodysplasin-A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Ectodysplasin-A ELISA kit

E04E0400-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Ectodysplasin-A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Ectodysplasin-A ELISA kit

E04E0400-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Ectodysplasin-A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Ectodysplasin-A ELISA kit

E04E0400-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Ectodysplasin-A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Ectodysplasin-A ELISA kit

E09E0400-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Ectodysplasin-A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Ectodysplasin-A ELISA kit

E09E0400-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Ectodysplasin-A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Ectodysplasin-A ELISA kit

E09E0400-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Ectodysplasin-A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Ectodysplasin-A ELISA kit

E08E0400-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Ectodysplasin-A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Ectodysplasin-A ELISA kit

E08E0400-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Ectodysplasin-A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Ectodysplasin-A ELISA kit

E08E0400-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Ectodysplasin-A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Ectodysplasin-A ELISA kit

E07E0400-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Ectodysplasin-A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Ectodysplasin-A ELISA kit

E07E0400-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Ectodysplasin-A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Ectodysplasin-A ELISA kit

E07E0400-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Ectodysplasin-A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Eda2r ELISA Kit| Mouse Tumor necrosis factor receptor superfami

EF014763 96 Tests
EUR 689

Edaradd ELISA Kit| Mouse Ectodysplasin-A receptor-associated ad

EF014766 96 Tests
EUR 689

EDAR Ectodysplasin A Receptor Human Recombinant Protein

PROTQ9UNE0 Regular: 20ug
EUR 317
Description: EDAR Human Recombinant produced in E.Coli is a single,non-glycosylated polypeptide chain containing 445 amino acids (27-448 a.a) andhaving a molecular mass of 48.2kDa. EDAR is fused to a 23 amino acid His-tag at N-terminus& purified by proprietary chromatographic techniques.

Human EPH Receptor A2 (EPHA2) ELISA Kit

abx252400-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Human Thromboxane A2 Receptor (TXA2R) ELISA Kit

abx253296-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Thromboxane A2 receptor, TBXA2R ELISA KIT

ELI-18790h 96 Tests
EUR 824

EDA2R Antibody

36434-100ul 100ul
EUR 252

EDA2R Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against EDA2R. Recognizes EDA2R from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

EDA2R Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against EDA2R. Recognizes EDA2R from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

EDA2R Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against EDA2R. Recognizes EDA2R from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

EDA2R Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against EDA2R. Recognizes EDA2R from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:200-1:1000, IHC:1:50-1:200


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA20363 50 ul
EUR 363
Description: Mouse polyclonal to EDA2R


YF-PA20364 50 ug
EUR 363
Description: Mouse polyclonal to EDA2R


YF-PA20365 100 ug
EUR 403
Description: Rabbit polyclonal to EDA2R


YF-PA26525 50 ul
EUR 334
Description: Mouse polyclonal to EDA2R

Mouse Eda/ Ectodysplasin-A ELISA Kit

E0441Mo 1 Kit
EUR 571

Guinea pig Ectodysplasin-A ELISA kit

E05E0400-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Ectodysplasin-A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Ectodysplasin-A ELISA kit

E05E0400-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Ectodysplasin-A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Ectodysplasin-A ELISA kit

E05E0400-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Ectodysplasin-A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Ectodysplasin A (EDA) ELISA Kit

abx255053-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

ELISA kit for Mouse Ectodysplasin-A

EK4143 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Ectodysplasin-A in samples from serum, plasma, tissue homogenates and other biological fluids.

Mouse Ectodysplasin- A, Eda ELISA KIT

ELI-06346m 96 Tests
EUR 865

Bovine Ectodysplasin- A, EDA ELISA KIT

ELI-06347b 96 Tests
EUR 928

Mouse Ectodysplasin-A(EDA) ELISA kit

CSB-EL007389MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Ectodysplasin-A (EDA) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Ectodysplasin-A(EDA) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Ectodysplasin-A(EDA) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Cow Ectodysplasin A (EDA) ELISA Kit

abx519005-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Ectodysplasin A (EDA) ELISA Kit

abx519007-96tests 96 tests
EUR 746
  • Shipped within 5-12 working days.

Mouse Eda(Ectodysplasin-A) ELISA Kit

EM0705 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: O54693
  • Alias: Eda/EDA protein homolog/Tabby protein/ED1/HED/EDA1/EDA2/HED1/ODT1/XHED/ECTD1/XLHED/ED1-A1/ED1-A2/EDA-A1/EDA-A2/STHAGX1/Ectodermal dysplasia protein
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.094 ng/ml

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

ELISA kit for Human Tumor necrosis factor receptor superfamily member 27 (EDA2R)

KTE61954-48T 48T
EUR 332
  • EDA-A1 and EDA-A2 are two isoforms of ectodysplasin that are encoded by the anhidrotic ectodermal dysplasia (EDA) gene. Mutations in EDA give rise to a clinical syndrome characterized by loss of hair, sweat glands, and teeth. The protein encoded by t
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Tumor necrosis factor receptor superfamily member 27 (EDA2R) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Tumor necrosis factor receptor superfamily member 27 (EDA2R)

KTE61954-5platesof96wells 5 plates of 96 wells
EUR 2115
  • EDA-A1 and EDA-A2 are two isoforms of ectodysplasin that are encoded by the anhidrotic ectodermal dysplasia (EDA) gene. Mutations in EDA give rise to a clinical syndrome characterized by loss of hair, sweat glands, and teeth. The protein encoded by t
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Tumor necrosis factor receptor superfamily member 27 (EDA2R) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Tumor necrosis factor receptor superfamily member 27 (EDA2R)

KTE61954-96T 96T
EUR 539
  • EDA-A1 and EDA-A2 are two isoforms of ectodysplasin that are encoded by the anhidrotic ectodermal dysplasia (EDA) gene. Mutations in EDA give rise to a clinical syndrome characterized by loss of hair, sweat glands, and teeth. The protein encoded by t
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Tumor necrosis factor receptor superfamily member 27 (EDA2R) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human EDA2R shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

EDA2R Recombinant Protein (Human)

RP010147 100 ug Ask for price

EDA ELISA Kit| Bovine Ectodysplasin-A ELISA Kit

EF011342 96 Tests
EUR 689

Eda ELISA Kit| Mouse Ectodysplasin-A ELISA Kit

EF013318 96 Tests
EUR 689

Human Phospholipase A2 Receptor 1 (PLA2R1)ELISA kit

201-12-2528 96 tests
EUR 440
  • This Phospholipase A2 Receptor 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Phospholipase A2 Receptor 1 (PLA2R1) ELISA Kit

DLR-PLA2R1-Hu-48T 48T
EUR 517
  • Should the Human Phospholipase A2 Receptor 1 (PLA2R1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Phospholipase A2 Receptor 1 (PLA2R1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Phospholipase A2 Receptor 1 (PLA2R1) ELISA Kit

DLR-PLA2R1-Hu-96T 96T
EUR 673
  • Should the Human Phospholipase A2 Receptor 1 (PLA2R1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Phospholipase A2 Receptor 1 (PLA2R1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Phospholipase A2 Receptor 1 (PLA2R1) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Phospholipase A2 Receptor 1 (PLA2R1) ELISA Kit

abx251380-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

ELISA kit for Human Secretory phospholipase A2 receptor

EK4191 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Secretory phospholipase A2 receptor in samples from serum, plasma, tissue homogenates and other biological fluids.

Human PLA2R1/ Secretory phospholipase A2 receptor ELISA Kit

E1955Hu 1 Kit
EUR 571

Human PLA2R1(Secretory phospholipase A2 receptor) ELISA Kit

EH2051 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q13018
  • Alias: PLA2R1(Secretory phospholipase A2 receptor)/CLEC13C/PLA2G1R/CLEC13CC-type lectin domain family 13 member C/phospholipase A2 receptor 1, 180kDa/PLA2IR/PLA2-RM-type receptor
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Secretory phospholipase A2 receptor, PLA2R1 ELISA KIT

ELI-06488h 96 Tests
EUR 824

Human Phospholipidase A2 Receptor antibody (IgG) ELISA Kit

CSB-E13287h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Qualitativeindirect ELISA kit for measuring Human Phospholipidase A2 Receptor antibody (IgG) in samples from serum. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Phospholipidase A2 Receptor antibody (IgG) ELISA Kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Qualitativeindirect ELISA kit for measuring Human Phospholipidase A2 Receptor antibody (IgG) in samples from serum. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Secretory phospholipase A2 receptor (PLA2R1) ELISA Kit

abx571020-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Phospholipase A2 Receptor 1(PLA2R1)ELISA Kit

QY-E02289 96T
EUR 361

Human Phospholipase A2 Receptor 1 ELISA Kit (PLA2R1)

RK02098 96 Tests
EUR 521

Human Phospholipase A2 Receptor 1 (PLA2R1) ELISA Kit

SED851Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Phospholipase A2 Receptor 1 (PLA2R1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Phospholipase A2 Receptor 1 (PLA2R1) in serum, plasma, tissue homogenates and other biological fluids.

Human Phospholipase A2 Receptor 1 (PLA2R1) ELISA Kit

SED851Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Phospholipase A2 Receptor 1 (PLA2R1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Phospholipase A2 Receptor 1 (PLA2R1) in serum, plasma, tissue homogenates and other biological fluids.

Human Phospholipase A2 Receptor 1 (PLA2R1) ELISA Kit

SED851Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Phospholipase A2 Receptor 1 (PLA2R1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Phospholipase A2 Receptor 1 (PLA2R1) in serum, plasma, tissue homogenates and other biological fluids.

Human Phospholipase A2 Receptor 1 (PLA2R1) ELISA Kit

SED851Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Phospholipase A2 Receptor 1 (PLA2R1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Phospholipase A2 Receptor 1 (PLA2R1) in serum, plasma, tissue homogenates and other biological fluids.

Human Phospholipase A2 Receptor 1 (PLA2R1) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Phospholipase A2 Receptor 1 elisa. Alternative names of the recognized antigen: CLEC13C
  • PLA2G1R
  • PLA2IR
  • PLA2R
  • 180 kDa secretory phospholipase A2 receptor
  • C-type lectin domain family 13 member C
  • Soluble secretory phospholipase A2 re
  • Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Phospholipase A2 Receptor 1 (PLA2R1) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Phospholipase A2 Receptor 1 (PLA2R1) ELISA Kit

RDR-PLA2R1-Hu-48Tests 48 Tests
EUR 544

Human Phospholipase A2 Receptor 1 (PLA2R1) ELISA Kit

RDR-PLA2R1-Hu-96Tests 96 Tests
EUR 756

Human Phospholipase A2 Receptor 1 (PLA2R1) ELISA Kit

RD-PLA2R1-Hu-48Tests 48 Tests
EUR 521

Human Phospholipase A2 Receptor 1 (PLA2R1) ELISA Kit

RD-PLA2R1-Hu-96Tests 96 Tests
EUR 723

Recombinant Mouse Ectodysplasin Receptor/EDAR (C-Fc)

CK76-10ug 10ug
EUR 146
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH 7.4.

Recombinant Mouse Ectodysplasin Receptor/EDAR (C-Fc)

CK76-1mg 1mg
EUR 2283
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH 7.4.

Recombinant Mouse Ectodysplasin Receptor/EDAR (C-Fc)

CK76-500ug 500ug
EUR 1613
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH 7.4.

Recombinant Mouse Ectodysplasin Receptor/EDAR (C-Fc)

CK76-50ug 50ug
EUR 303
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH 7.4.

Human Phospholipidase A2,PL-A2 ELISA Kit

201-12-0926 96 tests
EUR 440
  • This Phospholipidase A2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Thromboxane A2,TX-A2 ELISA Kit

201-12-1167 96 tests
EUR 440
  • This Thromboxane A2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Apolipoprotein A2, apo-A2 ELISA Kit

CSB-E13504h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Apolipoprotein A2, apo-A2 in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Apolipoprotein A2, apo-A2 ELISA Kit

  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Apolipoprotein A2, apo-A2 in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Phospholipidase A2,PL-A2 ELISA Kit

CN-03323H1 96T
EUR 439

Human Phospholipidase A2,PL-A2 ELISA Kit

CN-03323H2 48T
EUR 290

Human Thromboxane A2,TX-A2 ELISA Kit

CN-04093H1 96T
EUR 438

Human Thromboxane A2,TX-A2 ELISA Kit

CN-04093H2 48T
EUR 289

Human Phospholipidase A2(PL-A2)ELISA Kit

GA-E0942HM-48T 48T
EUR 289

Human Phospholipidase A2(PL-A2)ELISA Kit

GA-E0942HM-96T 96T
EUR 466

Human Thromboxane A2(TX-A2)ELISA Kit

GA-E1183HM-48T 48T
EUR 289

Human Thromboxane A2(TX-A2)ELISA Kit

GA-E1183HM-96T 96T
EUR 466

Human Apolipoprotein A2(APO-A2)ELISA Kit

QY-E00337 96T
EUR 394

Human Thromboxane A2(TX-A2)ELISA Kit

QY-E00645 96T
EUR 361

Human Phospholipidase A2(PL-A2)ELISA Kit

QY-E02291 96T
EUR 400

Bovine Thromboxane A2 receptor, TBXA2R ELISA KIT

ELI-13724b 96 Tests
EUR 928

Mouse Thromboxane A2 receptor, Tbxa2r ELISA KIT

ELI-53077m 96 Tests
EUR 865

Monkey EPH Receptor A2 (EPHA2) ELISA Kit

abx360311-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Pig Thromboxane A2 Receptor (TXA2R) ELISA Kit

abx360632-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Pig EPH Receptor A2 (EPHA2) ELISA Kit

abx362044-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit EPH Receptor A2 (EPHA2) ELISA Kit

abx363288-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Chicken EPH Receptor A2 (EPHA2) ELISA Kit

abx356840-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Monkey Thromboxane A2 Receptor (TXA2R) ELISA Kit

abx358965-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Chicken Thromboxane A2 Receptor (TXA2R) ELISA Kit

abx355582-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Thromboxane A2 Receptor (TXA2R) ELISA Kit

abx363607-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

EDA2R Conjugated Antibody

C36434 100ul
EUR 397

EDA2R cloning plasmid

CSB-CL881011HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 894
  • Sequence: atggattgccaagaaaatgagtactgggaccaatggggacggtgtgtcacctgccaacggtgtggtcctggacaggagctatccaaggattgtggttatggagagggtggagatgcctactgcacagcctgccctcctcgcaggtacaaaagcagctggggccaccacagatgtca
  • Show more
Description: A cloning plasmid for the EDA2R gene.

Anti-EDA2R (3C1)

YF-MA19144 100 ug
EUR 363
Description: Mouse monoclonal to EDA2R

Ectodysplasin A antibody

70R-14099 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal Ectodysplasin A antibody

Ectodysplasin A antibody

70R-5943 50 ug
EUR 467
Description: Rabbit polyclonal Ectodysplasin A antibody raised against the middle region of EDA

Ectodysplasin A antibody

70R-5969 50 ug
EUR 467
Description: Rabbit polyclonal Ectodysplasin A antibody raised against the middle region of EDA

ELISA kit for Human PLA2R1 (Phospholipase A2 Receptor 1)

E-EL-H1062 1 plate of 96 wells
EUR 534
  • Gentaur's PLA2R1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human PLA2R1. Standards or samples are added to the micro ELISA plate wells and combined wit
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human PLA2R1 (Phospholipase A2 Receptor 1) in samples from Serum, Plasma, Cell supernatant

Human Leukocyte Immunoglobulin Like Receptor A2 (LILRA2) ELISA Kit

abx251816-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Human EphA2(Tyrosine protein kinase receptor A2) ELISA Kit

EH3008 96T
EUR 524.1
  • Detection range: 78.125-5000 pg/ml
  • Uniprot ID: P29317
  • Alias: EphA2/Eck/Myk2/Sek2/ARCC2/EC 2.7.10/EC cell receptor protein tyrosine kinase/EPH receptor A2/EphA2/ephrin type-A receptor 2/Epithelial cell kinase/soluble EPHA2 varia
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.875pg/ml

ELISA kit for Human PLA2R1 (Phospholipase A2 Receptor 1)

ELK3558 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Phospholipase A2 Receptor 1 (PLA2R1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific
  • Show more
Description: A sandwich ELISA kit for detection of Phospholipase A2 Receptor 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human phospholipase A2 receptor 1, 180kDa (PLA2R1) ELISA kit

CSB-E13155h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human phospholipase A2 receptor 1, 180kDa (PLA2R1) in samples from serum, plasma, tissue homogenates, cell culture supernates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human phospholipase A2 receptor 1, 180kDa (PLA2R1) ELISA kit

  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human phospholipase A2 receptor 1, 180kDa (PLA2R1) in samples from serum, plasma, tissue homogenates, cell culture supernates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Phospholipidase A2 Receptor Antibody (IgG) (Human) ELISA Kit (OKCA00513)

OKCA00513 96 Wells
EUR 859
Description: Description of target: Phospholipidase A2 Receptor Antibody (IgG);Species reactivity: Human;Application: ;Assay info: Assay Methodology: Qualitative Reverse Capture ELISA;Sensitivity:

EDA2R ORF Vector (Human) (pORF)

ORF003383 1.0 ug DNA
EUR 95

Human soluble Phospholipase A2,sPL-A2 ELISA Kit

201-12-0876 96 tests
EUR 440
  • This soluble Phospholipase A2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human soluble Phospholipase A2,sPL-A2 ELISA Kit

CN-04617H1 96T
EUR 458

Human soluble Phospholipase A2,sPL-A2 ELISA Kit

CN-04617H2 48T
EUR 307

Human soluble Phospholipase A2(sPL-A2)ELISA Kit

GA-E0892HM-48T 48T
EUR 289

Human soluble Phospholipase A2(sPL-A2)ELISA Kit

GA-E0892HM-96T 96T
EUR 466

ELISA kit for Human Thromboxane A2 (TX-A2)

KTE62669-48T 48T
EUR 245
  • Thromboxane A2 (TXA2) is a thromboxane. It is produced by activated platelets and has prothrombotic properties? it stimulates activation of new platelets as well as increases platelet aggregation. This is achieved by mediating expression of the glyco
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Thromboxane A2 (TX-A2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Thromboxane A2 (TX-A2)

KTE62669-5platesof96wells 5 plates of 96 wells
EUR 1523
  • Thromboxane A2 (TXA2) is a thromboxane. It is produced by activated platelets and has prothrombotic properties? it stimulates activation of new platelets as well as increases platelet aggregation. This is achieved by mediating expression of the glyco
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Thromboxane A2 (TX-A2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Thromboxane A2 (TX-A2)

KTE62669-96T 96T
EUR 398
  • Thromboxane A2 (TXA2) is a thromboxane. It is produced by activated platelets and has prothrombotic properties? it stimulates activation of new platelets as well as increases platelet aggregation. This is achieved by mediating expression of the glyco
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Thromboxane A2 (TX-A2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human soluble Phospholipase A2(sPL-A2)ELISA Kit

QY-E02463 96T
EUR 361

Mouse Secretory phospholipase A2 receptor, Pla2r1 ELISA KIT

ELI-06489m 96 Tests
EUR 865

Bovine Secretory phospholipase A2 receptor, PLA2R1 ELISA KIT

ELI-06490b 96 Tests
EUR 928

Rabbit Secretory phospholipase A2 receptor, PLA2R1 ELISA KIT

ELI-06491Ra 96 Tests
EUR 928

Pig Phospholipase A2 Receptor 1 (PLA2R1) ELISA Kit

abx360893-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Guinea pig Thromboxane A2 Receptor (TXA2R) ELISA Kit

abx357455-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Guinea pig EPH Receptor A2 (EPHA2) ELISA Kit

abx357926-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Monkey Phospholipase A2 Receptor 1 (PLA2R1) ELISA Kit

abx358922-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Chicken Phospholipase A2 Receptor 1 (PLA2R1) ELISA Kit

abx355672-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Phospholipase A2 Receptor 1 (PLA2R1) ELISA Kit

abx363679-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Sheep Phospholipase A2 Receptor 1 (PLA2R1) ELISA Kit

abx364290-96tests 96 tests
EUR 926
  • Shipped within 5-12 working days.

Cow Secretory phospholipase A2 receptor (PLA2R1) ELISA Kit

abx519149-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Secretory phospholipase A2 receptor (PLA2R1) ELISA Kit

abx519151-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Phospholipase A2 Receptor 1(PLA2R1)ELISA kit

QY-E10545 96T
EUR 413

Mouse Phospholipase A2 Receptor 1(PLA2R1)ELISA kit

QY-E21170 96T
EUR 361

Human a2 Microglobulin ELISA kit

E01M0207-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human a2 Microglobulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human EDA2R(Ectodysplasin A2 Receptor) ELISA Kit