Human CPN2(Carboxypeptidase N2) ELISA Kit

To Order: Contact

Human Carboxypeptidase N2 (CPN2)ELISA Kit
201-12-2437	SunredBio	96 tests	EUR 440
This Carboxypeptidase N2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Carboxypeptidase N2(CPN2)ELISA Kit
QY-E01341	Qayee Biotechnology	96T	EUR 361

Human Carboxypeptidase N2 (CPN2) ELISA Kit
SEF324Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carboxypeptidase N2 (CPN2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carboxypeptidase N2 (CPN2) in serum, plasma, tissue homogenates and other biological fluids.

Human Carboxypeptidase N2 (CPN2) ELISA Kit
SEF324Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carboxypeptidase N2 (CPN2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carboxypeptidase N2 (CPN2) in serum, plasma, tissue homogenates and other biological fluids.

Human Carboxypeptidase N2 (CPN2) ELISA Kit
SEF324Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carboxypeptidase N2 (CPN2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carboxypeptidase N2 (CPN2) in serum, plasma, tissue homogenates and other biological fluids.

Human Carboxypeptidase N2 (CPN2) ELISA Kit
SEF324Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carboxypeptidase N2 (CPN2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carboxypeptidase N2 (CPN2) in serum, plasma, tissue homogenates and other biological fluids.

Human Carboxypeptidase N2 (CPN2) ELISA Kit
4-SEF324Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Carboxypeptidase N2 elisa. Alternative names of the recognized antigen: ACBP Carboxypeptidase N 83 kDa chain Carboxypeptidase N large subunit Carboxypeptidase N regulatory subunit Carboxypeptidase N polypeptide 2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Carboxypeptidase N2 (CPN2) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Carboxypeptidase N2 (CPN2) Antibody
20-abx129010	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Carboxypeptidase N2 (CPN2) Antibody
abx027272-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Carboxypeptidase N2 (CPN2) Antibody
abx027272-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Carboxypeptidase N2 (CPN2) Antibody
20-abx014322	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	100 ug 10 ug 200 ug 300 µg
Shipped within 5-10 working days.

Carboxypeptidase N2 (CPN2) Antibody
20-abx175702	Abbexa	EUR 1302.00 EUR 620.00	1 mg 200 ug
Please enquire.

Carboxypeptidase N2 (CPN2) Antibody
20-abx323544	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Carboxypeptidase N2 (CPN2) Antibody
abx330718-100ul	Abbexa	100 ul	EUR 425
Shipped within 5-10 working days.

Carboxypeptidase N2 (CPN2) Antibody
20-abx171569	Abbexa	EUR 913.00 EUR 467.00	1 mg 200 ug
Please enquire.

Recombinant Carboxypeptidase N2 (CPN2)
4-RPF324Hu01	Cloud-Clone	EUR 476.32 EUR 230.00 EUR 1511.20 EUR 570.40 EUR 1040.80 EUR 382.00 EUR 3628.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P22792 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 36.3kDa Isoelectric Point: 6.6
Description: Recombinant Human Carboxypeptidase N2 expressed in: E.coli

Rat Carboxypeptidase N2(CPN2)ELISA Kit
GA-E0867RT-48T	GenAsia Biotech	48T	EUR 317

Rat Carboxypeptidase N2(CPN2)ELISA Kit
GA-E0867RT-96T	GenAsia Biotech	96T	EUR 496

Rat Carboxypeptidase N2 (CPN2) ELISA Kit
20-abx155298	Abbexa	EUR 7237.00 EUR 3855.00 EUR 895.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Rat Carboxypeptidase N2(CPN2)ELISA Kit
QY-E10016	Qayee Biotechnology	96T	EUR 361

Rat Carboxypeptidase N2(CPN2)ELISA Kit
QY-E10785	Qayee Biotechnology	96T	EUR 361

Mouse Carboxypeptidase N2(CPN2)ELISA Kit
QY-E20261	Qayee Biotechnology	96T	EUR 361

Mouse Carboxypeptidase N2(CPN2)ELISA Kit
QY-E20262	Qayee Biotechnology	96T	EUR 361

Rat Carboxypeptidase N2 (CPN2) ELISA Kit
SEF324Ra-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5124.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Carboxypeptidase N2 (CPN2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Carboxypeptidase N2 (CPN2) in serum, plasma, tissue homogenates and other biological fluids.

Rat Carboxypeptidase N2 (CPN2) ELISA Kit
SEF324Ra-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 509.64
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Carboxypeptidase N2 (CPN2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Carboxypeptidase N2 (CPN2) in serum, plasma, tissue homogenates and other biological fluids.

Rat Carboxypeptidase N2 (CPN2) ELISA Kit
SEF324Ra-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 685.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Carboxypeptidase N2 (CPN2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Carboxypeptidase N2 (CPN2) in serum, plasma, tissue homogenates and other biological fluids.

Rat Carboxypeptidase N2 (CPN2) ELISA Kit
SEF324Ra-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2783.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Carboxypeptidase N2 (CPN2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Carboxypeptidase N2 (CPN2) in serum, plasma, tissue homogenates and other biological fluids.

Rat Carboxypeptidase N2 (CPN2) ELISA Kit
4-SEF324Ra	Cloud-Clone	EUR 5175.00 EUR 2734.00 EUR 686.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Carboxypeptidase N2 elisa. Alternative names of the recognized antigen: ACBP Carboxypeptidase N 83 kDa chain Carboxypeptidase N large subunit Carboxypeptidase N regulatory subunit Carboxypeptidase N polypeptide 2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Carboxypeptidase N2 (CPN2) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Carboxypeptidase N2 (CPN2) Protein
20-abx168138	Abbexa	EUR 662.00 EUR 272.00 EUR 2040.00 EUR 787.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Carboxypeptidase N2 (CPN2) CLIA Kit
20-abx494865	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human CPN2 (Carboxypeptidase N2)
ELK5042	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Carboxypeptidase N2 (CPN2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Carboxy Show more
Description: A sandwich ELISA kit for detection of Carboxypeptidase N2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Rat Carboxypeptidase N2 (CPN2) Protein
20-abx652777	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Rat Carboxypeptidase N2 (CPN2) CLIA Kit
20-abx494866	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Rat CPN2 (Carboxypeptidase N2)
ELK6729	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Carboxypeptidase N2 (CPN2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Carboxy Show more
Description: A sandwich ELISA kit for detection of Carboxypeptidase N2 from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Carboxypeptidase N2 (CPN2) Polyclonal Antibody (Human)
4-PAF324Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CPN2 (Gln249~Ala540) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Carboxypeptidase N2 (CPN2)

Carboxypeptidase N2 (CPN2) Polyclonal Antibody (Human), APC
4-PAF324Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CPN2 (Gln249~Ala540) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Carboxypeptidase N2 (CPN2). This antibody is labeled with APC.

Carboxypeptidase N2 (CPN2) Polyclonal Antibody (Human), Biotinylated
4-PAF324Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CPN2 (Gln249~Ala540) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Carboxypeptidase N2 (CPN2). This antibody is labeled with Biotin.

Carboxypeptidase N2 (CPN2) Polyclonal Antibody (Human), Cy3
4-PAF324Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CPN2 (Gln249~Ala540) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Carboxypeptidase N2 (CPN2). This antibody is labeled with Cy3.

Carboxypeptidase N2 (CPN2) Polyclonal Antibody (Human), FITC
4-PAF324Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CPN2 (Gln249~Ala540) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Carboxypeptidase N2 (CPN2). This antibody is labeled with FITC.

Carboxypeptidase N2 (CPN2) Polyclonal Antibody (Human), HRP
4-PAF324Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CPN2 (Gln249~Ala540) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Carboxypeptidase N2 (CPN2). This antibody is labeled with HRP.

Carboxypeptidase N2 (CPN2) Polyclonal Antibody (Human), PE
4-PAF324Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CPN2 (Gln249~Ala540) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Carboxypeptidase N2 (CPN2). This antibody is labeled with PE.

Carboxypeptidase N2 (CPN2) Polyclonal Antibody (Human), APC-Cy7
4-PAF324Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CPN2 (Gln249~Ala540) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Carboxypeptidase N2 (CPN2). This antibody is labeled with APC-Cy7.

Carboxypeptidase N2 antibody
70R-49584	Fitzgerald	100 ul	EUR 244
Description: Purified Polyclonal Carboxypeptidase N2 antibody

Carboxypeptidase N2 antibody
70R-3276	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal Carboxypeptidase N2 antibody raised against the N terminal of CPN2

Carboxypeptidase N2 Blocking Peptide
33R-3103	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CPN2 antibody, catalog no. 70R-3276

Human Carboxypeptidase N Subunit 2 (CPN2) ELISA Kit
abx512707-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human CPN2/ Carboxypeptidase N subunit 2 ELISA Kit
E0548Hu	Sunlong	1 Kit	EUR 571

Human Carboxypeptidase N subunit 2(CPN2) ELISA kit
E01C2009-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Carboxypeptidase N subunit 2(CPN2) ELISA kit
E01C2009-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Carboxypeptidase N subunit 2(CPN2) ELISA kit
E01C2009-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Carboxypeptidase N subunit 2(CPN2) ELISA kit
CSB-EL005899HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Carboxypeptidase N subunit 2 (CPN2) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Carboxypeptidase N subunit 2(CPN2) ELISA kit
1-CSB-EL005899HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Carboxypeptidase N subunit 2(CPN2) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Carboxypeptidase N 2 (CPN2) Antibody
20-abx009403	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Mouse Carboxypeptidase N Subunit 2 (CPN2) ELISA Kit
abx512708-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Goat Carboxypeptidase N subunit 2(CPN2) ELISA kit
E06C2009-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Carboxypeptidase N subunit 2(CPN2) ELISA kit
E06C2009-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Carboxypeptidase N subunit 2(CPN2) ELISA kit
E06C2009-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Carboxypeptidase N subunit 2(CPN2) ELISA kit
E02C2009-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Carboxypeptidase N subunit 2(CPN2) ELISA kit
E02C2009-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Carboxypeptidase N subunit 2(CPN2) ELISA kit
E02C2009-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Carboxypeptidase N subunit 2(CPN2) ELISA kit
E03C2009-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Carboxypeptidase N subunit 2(CPN2) ELISA kit
E03C2009-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Carboxypeptidase N subunit 2(CPN2) ELISA kit
E03C2009-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Carboxypeptidase N subunit 2(CPN2) ELISA kit
E04C2009-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Carboxypeptidase N subunit 2(CPN2) ELISA kit
E04C2009-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Carboxypeptidase N subunit 2(CPN2) ELISA kit
E04C2009-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Carboxypeptidase N subunit 2(CPN2) ELISA kit
E07C2009-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Carboxypeptidase N subunit 2(CPN2) ELISA kit
E07C2009-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Carboxypeptidase N subunit 2(CPN2) ELISA kit
E07C2009-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Carboxypeptidase N subunit 2(CPN2) ELISA kit
E08C2009-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Carboxypeptidase N subunit 2(CPN2) ELISA kit
E08C2009-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Carboxypeptidase N subunit 2(CPN2) ELISA kit
E08C2009-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Carboxypeptidase N subunit 2(CPN2) ELISA kit
E09C2009-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Carboxypeptidase N subunit 2(CPN2) ELISA kit
E09C2009-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Carboxypeptidase N subunit 2(CPN2) ELISA kit
E09C2009-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Carboxypeptidase N subunit 2(CPN2) ELISA kit
E05C2009-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Carboxypeptidase N subunit 2(CPN2) ELISA kit
E05C2009-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Carboxypeptidase N subunit 2(CPN2) ELISA kit
E05C2009-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

CPN2 ELISA KIT|Human
EF007457	Lifescience Market	96 Tests	EUR 689

CPN2 ELISA Kit (Human) (OKCD00699)
OKCD00699	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: The 83 kDa subunit binds and stabilizes the catalytic subunit at 37 degrees Celsius and keeps it in circulation. Under some circumstances it may be an allosteric modifier of the catalytic subunit. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.63 ng/mL

CPN2 ELISA Kit (Human) (OKEH06913)
OKEH06913	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: The 83 kDa subunit binds and stabilizes the catalytic subunit at 37 degrees Celsius and keeps it in circulation. Under some circumstances it may be an allosteric modifier of the catalytic subunit. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.78U/L

N2,N2-Dimethylguanosine
HY-113137	MedChemExpress	5mg	EUR 187

CPN2 ELISA Kit (Rat) (OKCD08772)
OKCD08772	Aviva Systems Biology	96 Wells	EUR 1053
Description: Description of target: ;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 0.61ng/mL

Human Protein Kinase N2(PKN2)ELISA Kit
QY-E03859	Qayee Biotechnology	96T	EUR 361

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

CPN2 siRNA
20-abx912672	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CPN2 siRNA
20-abx912673	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CPN2 antibody
70R-37038	Fitzgerald	100 ug	EUR 327
Description: Rabbit Polyclonal CPN2 antibody

CPN2 Antibody
ABD3901	Lifescience Market	100 ug	EUR 438

CPN2 Antibody
34551-100ul	SAB	100ul	EUR 252

CPN2 Antibody
34551-50ul	SAB	50ul	EUR 187

CPN2 Antibody
DF3901	Affbiotech	200ul	EUR 304
Description: CPN2 Antibody detects endogenous levels of total CPN2.

CPN2 Antibody
1-CSB-PA007245	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CPN2. Recognizes CPN2 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

CPN2 Antibody
CSB-PA276934-	Cusabio		EUR 335
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against CPN2. Recognizes CPN2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

CPN2 Antibody
CSB-PA276934-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against CPN2. Recognizes CPN2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

N2-Methylguanosine
HY-111647	MedChemExpress	10mg	EUR 337

pEGFP- N2
PVT1203	Lifescience Market	2 ug	EUR 241

Bacopaside N2
TBW00873	ChemNorm	5mg	Ask for price

Human Carboxypeptidase B1 ELISA kit
E01C0730-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase B1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Carboxypeptidase B1 ELISA kit
E01C0730-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase B1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Carboxypeptidase B1 ELISA kit
E01C0730-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase B1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Carboxypeptidase A1 ELISA KIT|Human
EF008381	Lifescience Market	96 Tests	EUR 689

Carboxypeptidase A2 ELISA KIT|Human
EF008382	Lifescience Market	96 Tests	EUR 689

Carboxypeptidase A3 ELISA KIT|Human
EF008383	Lifescience Market	96 Tests	EUR 689

Carboxypeptidase A5 ELISA KIT|Human
EF008384	Lifescience Market	96 Tests	EUR 689

Carboxypeptidase A6 ELISA KIT|Human
EF008385	Lifescience Market	96 Tests	EUR 689

Human CPN2 shRNA Plasmid
20-abx950959	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

CPN2 Recombinant Protein (Human)
RP038263	ABM	100 ug	Ask for price

Human Forkhead box protein N2, FOXN2 ELISA KIT
ELI-27523h	Lifescience Market	96 Tests	EUR 824

CPN2 Conjugated Antibody
C34551	SAB	100ul	EUR 397

CPN2 cloning plasmid
CSB-CL005899HU-10ug	Cusabio	10ug	EUR 569
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1638 Sequence: ATGCTCCCTGGAGCCTGGCTGCTCTGGACCTCCCTCCTGCTCCTGGCCAGGCCTGCCCAGCCCTGTCCCATGGGTTGTGACTGCTTCGTCCAGGAGGTGTTCTGCTCAGATGAGGAGCTTGCCACCGTCCCGCTGGACATCCCGCCATATACGAAAAACATCATCTTTGTGGAGA Show more
Description: A cloning plasmid for the CPN2 gene.

Anti-CPN2 Antibody
A05815	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal CPN2 Antibody. Validated in WB and tested in Human.

CPN2 Blocking Peptide
DF3901-BP	Affbiotech	1mg	EUR 195

pCMV-SPORT6-CPN2
PVT14455	Lifescience Market	2 ug	EUR 495

Rat Protein Kinase N2(PKN2)ELISA Kit
QY-E10166	Qayee Biotechnology	96T	EUR 361

Mouse Protein Kinase N2(PKN2)ELISA Kit
QY-E21278	Qayee Biotechnology	96T	EUR 361

Human Carboxypeptidase A2 (CPA2) ELISA Kit
abx512714-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Carboxypeptidase B2 (CPB2) ELISA Kit
abx573782-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-12 working days.

Human Carboxypeptidase M (CPM) ELISA Kit
abx576436-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human CPA2/ Carboxypeptidase A2 ELISA Kit
E0543Hu	Sunlong	1 Kit	EUR 571

Human CPB2/ Carboxypeptidase B2 ELISA Kit
E0545Hu	Sunlong	1 Kit	EUR 571

Human CPM/ Carboxypeptidase M ELISA Kit
E0547Hu	Sunlong	1 Kit	EUR 571

Human Probable carboxypeptidase (PM20D1) ELISA kit
E01P0720-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Probable carboxypeptidase (PM20D1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Probable carboxypeptidase (PM20D1) ELISA kit
E01P0720-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Probable carboxypeptidase (PM20D1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CPN2(Carboxypeptidase N2) ELISA Kit