Human ASAH2(N-Acylsphingosine Amidohydrolase 2) ELISA Kit

To Order: Contact

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody
abx025039-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody
20-abx214010	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody
20-abx214011	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody
20-abx177710	Abbexa	EUR 1205.00 EUR 578.00	1 mg 200 ug
Please enquire.

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody
20-abx173712	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody
20-abx303129	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) ELISA Kit
20-abx156834	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human N-Acylsphingosine Amidohydrolase 2(ASAH2)ELISA Kit
QY-E04735	Qayee Biotechnology	96T	EUR 361

Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) ELISA Kit
SEE689Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter- Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) in serum, plasma, tissue homogenates and other biological fluids.

Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) ELISA Kit
SEE689Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter- Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) in serum, plasma, tissue homogenates and other biological fluids.

Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) ELISA Kit
SEE689Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter- Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) in serum, plasma, tissue homogenates and other biological fluids.

Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) ELISA Kit
SEE689Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter- Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) in serum, plasma, tissue homogenates and other biological fluids.

Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) ELISA Kit
4-SEE689Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as N-Acylsphingosine Amidohydrolase 2 elisa. Alternative names of the recognized antigen: HNAC1 non-lysosomal ceramidase Neutral ceramidase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) Protein
20-abx654471	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) CLIA Kit
20-abx494694	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human ASAH2 (N-Acylsphingosine Amidohydrolase 2)
ELK5107	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to N-Acylsphingosine Amidohydrolase 2 (ASAH2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody spe Show more
Description: A sandwich ELISA kit for detection of N-Acylsphingosine Amidohydrolase 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody (HRP)
20-abx303130	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody (FITC)
20-abx303131	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody (Biotin)
20-abx303132	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Human N-Acylsphingosine Amidohydrolase 1 (ASAH1) ELISA Kit
DLR-ASAH1-Hu-48T	DL Develop	48T	EUR 517
Should the Human N-Acylsphingosine Amidohydrolase 1 (ASAH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human N-Acylsphingosine Amidohydrolase 1 (ASAH1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human N-Acylsphingosine Amidohydrolase 1 (ASAH1) ELISA Kit
DLR-ASAH1-Hu-96T	DL Develop	96T	EUR 673
Should the Human N-Acylsphingosine Amidohydrolase 1 (ASAH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human N-Acylsphingosine Amidohydrolase 1 (ASAH1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human N-Acylsphingosine Amidohydrolase 1 (ASAH1) ELISA Kit
20-abx150748	Abbexa	EUR 6642.00 EUR 3542.00 EUR 825.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human N-Acylsphingosine Amidohydrolase 1 ELISA Kit (ASAH1)
RK00948	Abclonal	96 Tests	EUR 521

Human N-Acylsphingosine Amidohydrolase 1 (ASAH1) ELISA Kit
RDR-ASAH1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human N-Acylsphingosine Amidohydrolase 1 (ASAH1) ELISA Kit
RDR-ASAH1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human N-Acylsphingosine Amidohydrolase 1 (ASAH1) ELISA Kit
SEC302Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human N-Acylsphingosine Amidohydrolase 1 (ASAH1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter- Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human N-Acylsphingosine Amidohydrolase 1 (ASAH1) in tissue homogenates, cell lysates and other biological fluids.

Human N-Acylsphingosine Amidohydrolase 1 (ASAH1) ELISA Kit
SEC302Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human N-Acylsphingosine Amidohydrolase 1 (ASAH1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter- Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human N-Acylsphingosine Amidohydrolase 1 (ASAH1) in tissue homogenates, cell lysates and other biological fluids.

Human N-Acylsphingosine Amidohydrolase 1 (ASAH1) ELISA Kit
SEC302Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human N-Acylsphingosine Amidohydrolase 1 (ASAH1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter- Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human N-Acylsphingosine Amidohydrolase 1 (ASAH1) in tissue homogenates, cell lysates and other biological fluids.

Human N-Acylsphingosine Amidohydrolase 1 (ASAH1) ELISA Kit
SEC302Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human N-Acylsphingosine Amidohydrolase 1 (ASAH1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter- Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human N-Acylsphingosine Amidohydrolase 1 (ASAH1) in tissue homogenates, cell lysates and other biological fluids.

Human N-Acylsphingosine Amidohydrolase 1 (ASAH1) ELISA Kit
4-SEC302Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as N-Acylsphingosine Amidohydrolase 1 elisa. Alternative names of the recognized antigen: AC ASAH PHP PHP32 Acid Ceramidase Acylsphingosine deacylase Putative 32 kDa heart protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human N-Acylsphingosine Amidohydrolase 1 (ASAH1) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human N-Acylsphingosine Amidohydrolase 1 (ASAH1) ELISA Kit
RD-ASAH1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human N-Acylsphingosine Amidohydrolase 1 (ASAH1) ELISA Kit
RD-ASAH1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

N-Acylsphingosine Amidohydrolase 1 (ASAH1) Antibody
20-abx005006	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

N-Acylsphingosine Amidohydrolase 1 (ASAH1) Antibody
20-abx214784	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

N-Acylsphingosine Amidohydrolase 1 (ASAH1) Antibody
20-abx113985	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

N-Acylsphingosine Amidohydrolase 1 (ASAH1) Antibody
20-abx128162	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

N-Acylsphingosine Amidohydrolase 1 (ASAH1) Antibody
20-abx173711	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

N-Acylsphingosine Amidohydrolase 1 (ASAH1) Antibody
20-abx241022	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

N-Acylsphingosine Amidohydrolase 1 (ASAH1) Antibody
20-abx320092	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

N-Acylsphingosine Amidohydrolase 1 (ASAH1) Antibody
20-abx322330	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

N-Acylsphingosine Amidohydrolase 1 (ASAH1) Antibody
20-abx301890	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

N-Acylsphingosine Amidohydrolase 1 (ASAH1) Antibody
abx230618-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Recombinant N-Acylsphingosine Amidohydrolase 1 (ASAH1)
4-RPC302Hu01	Cloud-Clone	EUR 467.36 EUR 228.00 EUR 1477.60 EUR 559.20 EUR 1018.40 EUR 376.00 EUR 3544.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q13510 Buffer composition: 100mMNaHCO3, 500mMNaCl, pH8.3, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 32.7kDa Isoelectric Point: 7.5
Description: Recombinant Human N-Acylsphingosine Amidohydrolase 1 expressed in: E.coli

ELISA kit for Human ASAH1 (N-Acylsphingosine Amidohydrolase 1)
ELK2966	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to N-Acylsphingosine Amidohydrolase 1 (ASAH1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody spe Show more
Description: A sandwich ELISA kit for detection of N-Acylsphingosine Amidohydrolase 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human N-Acylsphingosine Amidohydrolase 1 (ASAH1) CLIA Kit
20-abx493599	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human N-Acylsphingosine Amidohydrolase 1 (ASAH1) Protein
20-abx166591	Abbexa	EUR 648.00 EUR 272.00 EUR 1998.00 EUR 773.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

N-Acylsphingosine Amidohydrolase 1 (ASAH1) Antibody (HRP)
20-abx317374	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

N-Acylsphingosine Amidohydrolase 1 (ASAH1) Antibody (FITC)
20-abx317375	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

N-Acylsphingosine Amidohydrolase 1 (ASAH1) Antibody (Biotin)
20-abx317376	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

N-Acylsphingosine Amidohydrolase 1 (ASAH1) Polyclonal Antibody (Human, Mouse)
4-PAC302Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ASAH1 (Cys143~Trp395) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse N-Acylsphingosine Amidohydrolase 1 (ASAH1)

N-Acylsphingosine Amidohydrolase 1 (ASAH1) Polyclonal Antibody (Human, Mouse), APC
4-PAC302Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ASAH1 (Cys143~Trp395) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse N-Acylsphingosine Amidohydrolase 1 (ASAH1). This antibody is labeled with APC.

N-Acylsphingosine Amidohydrolase 1 (ASAH1) Polyclonal Antibody (Human, Mouse), Biotinylated
4-PAC302Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ASAH1 (Cys143~Trp395) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse N-Acylsphingosine Amidohydrolase 1 (ASAH1). This antibody is labeled with Biotin.

N-Acylsphingosine Amidohydrolase 1 (ASAH1) Polyclonal Antibody (Human, Mouse), Cy3
4-PAC302Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ASAH1 (Cys143~Trp395) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse N-Acylsphingosine Amidohydrolase 1 (ASAH1). This antibody is labeled with Cy3.

N-Acylsphingosine Amidohydrolase 1 (ASAH1) Polyclonal Antibody (Human, Mouse), FITC
4-PAC302Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ASAH1 (Cys143~Trp395) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse N-Acylsphingosine Amidohydrolase 1 (ASAH1). This antibody is labeled with FITC.

N-Acylsphingosine Amidohydrolase 1 (ASAH1) Polyclonal Antibody (Human, Mouse), HRP
4-PAC302Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ASAH1 (Cys143~Trp395) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse N-Acylsphingosine Amidohydrolase 1 (ASAH1). This antibody is labeled with HRP.

N-Acylsphingosine Amidohydrolase 1 (ASAH1) Polyclonal Antibody (Human, Mouse), PE
4-PAC302Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ASAH1 (Cys143~Trp395) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse N-Acylsphingosine Amidohydrolase 1 (ASAH1). This antibody is labeled with PE.

N-Acylsphingosine Amidohydrolase 1 (ASAH1) Polyclonal Antibody (Human, Mouse), APC-Cy7
4-PAC302Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ASAH1 (Cys143~Trp395) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse N-Acylsphingosine Amidohydrolase 1 (ASAH1). This antibody is labeled with APC-Cy7.

ASAH2 ELISA Kit (Human) (OKCD01831)
OKCD01831	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: Hydrolyzes the sphingolipid ceramide into sphingosine and free fatty acid at an optimal pH of 6.5-8.5. Acts as a key regulator of sphingolipid signaling metabolites by generating sphingosine at the cell surface. Acts as a repressor of apoptosis both by reducing C16-ceramide, thereby preventing ceramide-induced apoptosis, and generating sphingosine, a precursor of the antiapoptotic factor sphingosine 1-phosphate. Probably involved in the digestion of dietary sphingolipids in intestine by acting as a key enzyme for the catabolism of dietary sphingolipids and regulating the levels of bioactive sphingolipid metabolites in the intestinal tract.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.31 ng/mL

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Human Protein N terminal asparagine amidohydrolase(NTAN1) ELISA kit
E01P0818-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Protein N terminal asparagine amidohydrolase(NTAN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Protein N terminal asparagine amidohydrolase(NTAN1) ELISA kit
E01P0818-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Protein N terminal asparagine amidohydrolase(NTAN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Protein N terminal asparagine amidohydrolase(NTAN1) ELISA kit
E01P0818-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Protein N terminal asparagine amidohydrolase(NTAN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human Protein N-terminal asparagine amidohydrolase
EK3211	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Protein N-terminal asparagine amidohydrolase in samples from serum, plasma, tissue homogenates and other biological fluids.

Human NTAN1/ Protein N-terminal asparagine amidohydrolase ELISA Kit
E1801Hu	Sunlong	1 Kit	EUR 605

Human Protein N-terminal glutamine amidohydrolase (WDYHV1) ELISA Kit
abx385518-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Protein N-terminal asparagine amidohydrolase (NTAN1) ELISA Kit
abx555958-96tests	Abbexa	96 tests	EUR 668
Shipped within 1-3 weeks.

Human Protein N- terminal asparagine amidohydrolase, NTAN1 ELISA
ELI-44216h	Lifescience Market	96 Tests	EUR 824

Rabbit Protein N terminal asparagine amidohydrolase(NTAN1) ELISA kit
E04P0818-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Protein N terminal asparagine amidohydrolase(NTAN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Protein N terminal asparagine amidohydrolase(NTAN1) ELISA kit
E04P0818-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Protein N terminal asparagine amidohydrolase(NTAN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Protein N terminal asparagine amidohydrolase(NTAN1) ELISA kit
E04P0818-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Protein N terminal asparagine amidohydrolase(NTAN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Protein N terminal asparagine amidohydrolase(NTAN1) ELISA kit
E02P0818-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Protein N terminal asparagine amidohydrolase(NTAN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Protein N terminal asparagine amidohydrolase(NTAN1) ELISA kit
E02P0818-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Protein N terminal asparagine amidohydrolase(NTAN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Protein N terminal asparagine amidohydrolase(NTAN1) ELISA kit
E02P0818-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Protein N terminal asparagine amidohydrolase(NTAN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Protein N terminal asparagine amidohydrolase(NTAN1) ELISA kit
E03P0818-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Protein N terminal asparagine amidohydrolase(NTAN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Protein N terminal asparagine amidohydrolase(NTAN1) ELISA kit
E03P0818-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Protein N terminal asparagine amidohydrolase(NTAN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Protein N terminal asparagine amidohydrolase(NTAN1) ELISA kit
E03P0818-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Protein N terminal asparagine amidohydrolase(NTAN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Protein N terminal asparagine amidohydrolase(NTAN1) ELISA kit
E06P0818-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Protein N terminal asparagine amidohydrolase(NTAN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Protein N terminal asparagine amidohydrolase(NTAN1) ELISA kit
E06P0818-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Protein N terminal asparagine amidohydrolase(NTAN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Protein N terminal asparagine amidohydrolase(NTAN1) ELISA kit
E06P0818-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Protein N terminal asparagine amidohydrolase(NTAN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Protein N terminal asparagine amidohydrolase(NTAN1) ELISA kit
E08P0818-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Protein N terminal asparagine amidohydrolase(NTAN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Protein N terminal asparagine amidohydrolase(NTAN1) ELISA kit
E08P0818-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Protein N terminal asparagine amidohydrolase(NTAN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Protein N terminal asparagine amidohydrolase(NTAN1) ELISA kit
E08P0818-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Protein N terminal asparagine amidohydrolase(NTAN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Protein N terminal asparagine amidohydrolase(NTAN1) ELISA kit
E07P0818-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Protein N terminal asparagine amidohydrolase(NTAN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Protein N terminal asparagine amidohydrolase(NTAN1) ELISA kit
E07P0818-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Protein N terminal asparagine amidohydrolase(NTAN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Protein N terminal asparagine amidohydrolase(NTAN1) ELISA kit
E07P0818-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Protein N terminal asparagine amidohydrolase(NTAN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Protein N terminal asparagine amidohydrolase(NTAN1) ELISA kit
E09P0818-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Protein N terminal asparagine amidohydrolase(NTAN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Protein N terminal asparagine amidohydrolase(NTAN1) ELISA kit
E09P0818-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Protein N terminal asparagine amidohydrolase(NTAN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Protein N terminal asparagine amidohydrolase(NTAN1) ELISA kit
E09P0818-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Protein N terminal asparagine amidohydrolase(NTAN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Protein N-terminal glutamine amidohydrolase (WDYHV1) ELISA Kit
abx392118-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Pig Protein N-terminal asparagine amidohydrolase (NTAN1) ELISA Kit
abx555663-96tests	Abbexa	96 tests	EUR 911
Shipped within 1-3 weeks.

Mouse Protein N-terminal asparagine amidohydrolase (NTAN1) ELISA Kit
abx556057-96tests	Abbexa	96 tests	EUR 668
Shipped within 1-3 weeks.

Mouse Protein N-terminal glutamine amidohydrolase (WDYHV1) ELISA Kit
abx390862-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

ASAH2 Protein Vector (Human) (pPB-N-His)
PV049014	ABM	500 ng	EUR 481

Human ASAH2 (Neutral ceramidase) ELISA Kit (CUSTOM)
ELI-34330h	Lifescience Market	96 Tests	EUR 824

ASAH2 Antibody
24731-100ul	SAB	100ul	EUR 390

ASAH2 antibody
70R-12124	Fitzgerald	100 ug	EUR 403
Description: Rabbit polyclonal ASAH2 antibody

ASAH2 Antibody
36240-100ul	SAB	100ul	EUR 252

ASAH2 Antibody
3828-100	Biovision		EUR 316

ASAH2 Antibody
3828-30T	Biovision		EUR 146

ASAH2 Antibody
1-CSB-PA002170EA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ASAH2. Recognizes ASAH2 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:100-1:500, IF:1:50-1:500

ASAH2 Antibody
1-CSB-PA076840	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ASAH2. Recognizes ASAH2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

ASAH2 Antibody
1-CSB-PA133826	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ASAH2. Recognizes ASAH2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

ASAH2 siRNA
20-abx900469	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ASAH2 siRNA
20-abx908269	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ASAH2 siRNA
20-abx908270	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Mouse Protein N- terminal asparagine amidohydrolase, Ntan1 ELISA
ELI-22414m	Lifescience Market	96 Tests	EUR 865

Guinea pig Protein N terminal asparagine amidohydrolase(NTAN1) ELISA kit
E05P0818-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Protein N terminal asparagine amidohydrolase(NTAN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Protein N terminal asparagine amidohydrolase(NTAN1) ELISA kit
E05P0818-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Protein N terminal asparagine amidohydrolase(NTAN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Protein N terminal asparagine amidohydrolase(NTAN1) ELISA kit
E05P0818-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Protein N terminal asparagine amidohydrolase(NTAN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Recombinant Human Protein N-terminal Glutamine Amidohydrolase/NTAQ1
CK09-10ug	Novoprotein	10ug	EUR 156
Description: Supplied as a 0.2 μm filtered solution of PBS,100mM GSH,1% TritonX-100,15% glycerol,pH7.4.

Recombinant Human Protein N-terminal Glutamine Amidohydrolase/NTAQ1
CK09-1mg	Novoprotein	1mg	EUR 2283
Description: Supplied as a 0.2 μm filtered solution of PBS,100mM GSH,1% TritonX-100,15% glycerol,pH7.4.

Recombinant Human Protein N-terminal Glutamine Amidohydrolase/NTAQ1
CK09-500ug	Novoprotein	500ug	EUR 1613
Description: Supplied as a 0.2 μm filtered solution of PBS,100mM GSH,1% TritonX-100,15% glycerol,pH7.4.

Recombinant Human Protein N-terminal Glutamine Amidohydrolase/NTAQ1
CK09-50ug	Novoprotein	50ug	EUR 369
Description: Supplied as a 0.2 μm filtered solution of PBS,100mM GSH,1% TritonX-100,15% glycerol,pH7.4.

ASAH2 sgRNA CRISPR Lentivector (Human) (Target 2)
K0130503	ABM	1.0 ug DNA	EUR 154

Human ASAH2 shRNA Plasmid
20-abx961153	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

ASAH2 Recombinant Protein (Human)
RP036760	ABM	100 ug	Ask for price

AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-2	CORNING	1/pk	EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Protein N-Terminal Glutamine Amidohydrolase (WDYHV1) Antibody
abx036296-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Protein N-Terminal Asparagine Amidohydrolase (NTAN1) Antibody
abx122137-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Protein N-Terminal Asparagine Amidohydrolase (NTAN1) Antibody
abx029762-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Protein N-Terminal Asparagine Amidohydrolase (NTAN1) Antibody
abx029762-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Protein N-Terminal Glutamine Amidohydrolase (WDYHV1) Antibody
20-abx318315	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

ASAH2 Protein Vector (Mouse) (pPB-N-His)
PV156551	ABM	500 ng	EUR 1065

ASAH2 Protein Vector (Rat) (pPB-N-His)
PV254815	ABM	500 ng	EUR 1166

Mouse ASAH2 (Neutral ceramidase) ELISA Kit (CUSTOM)
ELI-34287m	Lifescience Market	96 Tests	EUR 865

Rat ASAH2 (Neutral ceramidase) ELISA Kit (CUSTOM)
ELI-48960r	Lifescience Market	96 Tests	EUR 886

ASAH2 Protein Vector (Human) (pPM-N-D-C-HA)
PV324140	ABM	500 ng	EUR 481

ASAH2 Protein Vector (Human) (pPM-N-D-C-His)
PV324141	ABM	500 ng	EUR 481

ASAH2 Rabbit pAb
A12596-100ul	Abclonal	100 ul	EUR 308

ASAH2 Rabbit pAb
A12596-200ul	Abclonal	200 ul	EUR 459

ASAH2 Rabbit pAb
A12596-20ul	Abclonal	20 ul	EUR 183

ASAH2 Rabbit pAb
A12596-50ul	Abclonal	50 ul	EUR 223

ASAH2 Blocking Peptide
33R-10941	Fitzgerald	50 ug	EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ASAH2 antibody, catalog no. 70R-12124

ASAH2 Blocking Peptide
3828BP-50	Biovision		EUR 153

Polyclonal ASAH2 Antibody
APG02010G	Leading Biology	0.1 mg	EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ASAH2 . This antibody is tested and proven to work in the following applications:

Polyclonal ASAH2 Antibody
APG02011G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ASAH2 . This antibody is tested and proven to work in the following applications:

ASAH2 Conjugated Antibody
C36240	SAB	100ul	EUR 397

ASAH2 cloning plasmid
CSB-CL865115HU-10ug	Cusabio	10ug	EUR 474
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2181 Sequence: ATGAGTGCCATCACAGTGGCCCTTCTCAGCCTCTTGTTTATCACCAGTGGGACCATTGAAAACCACAAAGATTTAGGAGGCCATTTTTTTTCAACCACCCAAAGCCCTCCAGCCACCCAGGGCTCCACAGCCGCCCAACGCTCCACAGCCACCCAGCATTCCACAGCCACCCAGA Show more
Description: A cloning plasmid for the ASAH2 gene.

ASAH2 Rabbit pAb
A7985-100ul	Abclonal	100 ul	EUR 308

ASAH2 Rabbit pAb
A7985-200ul	Abclonal	200 ul	EUR 459

ASAH2 Rabbit pAb
A7985-20ul	Abclonal	20 ul	EUR 183

ASAH2 Rabbit pAb
A7985-50ul	Abclonal	50 ul	EUR 223

ASAH2 Polyclonal Antibody
A62106	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

Anti-ASAH2 antibody
STJ110292	St John's Laboratory	100 µl	EUR 277

Anti-ASAH2 antibody
STJ114470	St John's Laboratory	100 µl	EUR 277

ASAH2 ORF Vector (Human) (pORF)
ORF012254	ABM	1.0 ug DNA	EUR 354

Protein N-Terminal Glutamine Amidohydrolase (WDYHV1) Antibody (HRP)
20-abx310044	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Protein N-Terminal Glutamine Amidohydrolase (WDYHV1) Antibody (FITC)
20-abx310045	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Protein N-Terminal Glutamine Amidohydrolase (WDYHV1) Antibody (Biotin)
20-abx310046	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Porcine Protein N- terminal asparagine amidohydrolase, NTAN1 ELI
ELI-36835p	Lifescience Market	96 Tests	EUR 928

Recombinant Human N-Acyl-Aromatic-L-Amino Acid Amidohydrolase/ACY3 (N-6His)
CH99-10ug	Novoprotein	10ug	EUR 156
Description: Supplied as a 0.2 μm filtered solution of 20mM Tris,100mM NaCl,1mM DTT,10%Glycerol,pH 8.0.

Recombinant Human N-Acyl-Aromatic-L-Amino Acid Amidohydrolase/ACY3 (N-6His)
CH99-1mg	Novoprotein	1mg	EUR 2283
Description: Supplied as a 0.2 μm filtered solution of 20mM Tris,100mM NaCl,1mM DTT,10%Glycerol,pH 8.0.

Recombinant Human N-Acyl-Aromatic-L-Amino Acid Amidohydrolase/ACY3 (N-6His)
CH99-500ug	Novoprotein	500ug	EUR 1613
Description: Supplied as a 0.2 μm filtered solution of 20mM Tris,100mM NaCl,1mM DTT,10%Glycerol,pH 8.0.

Recombinant Human N-Acyl-Aromatic-L-Amino Acid Amidohydrolase/ACY3 (N-6His)
CH99-50ug	Novoprotein	50ug	EUR 369
Description: Supplied as a 0.2 μm filtered solution of 20mM Tris,100mM NaCl,1mM DTT,10%Glycerol,pH 8.0.

Asah2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7087003	ABM	1.0 ug DNA	EUR 154

Asah2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3499603	ABM	1.0 ug DNA	EUR 154

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

ASAH2 Antibody, HRP conjugated
1-CSB-PA002170EB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ASAH2. Recognizes ASAH2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ASAH2 Antibody, FITC conjugated
1-CSB-PA002170EC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ASAH2. Recognizes ASAH2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ASAH2 Antibody, Biotin conjugated
1-CSB-PA002170ED01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ASAH2. Recognizes ASAH2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Mouse ASAH2 shRNA Plasmid
20-abx974501	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat ASAH2 shRNA Plasmid
20-abx987160	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

ASAH2 Recombinant Protein (Mouse)
RP117410	ABM	100 ug	Ask for price

ASAH2 Recombinant Protein (Rat)
RP191108	ABM	100 ug	Ask for price

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Acylsphingosine Deacylase 3 (ASAH3) Antibody
20-abx147917	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Human Plasma high density lipoprotein (HDL) native, purified
HDLD31-N-2	Alpha Diagnostics	2 mg	EUR 408

ASAH2 sgRNA CRISPR Lentivector set (Human)
K0130501	ABM	3 x 1.0 ug	EUR 339

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

Human Plasma low density lipoprotein (dil-LDL) Dil-labeled, purified
LDLD15-N-2	Alpha Diagnostics	200 ug	EUR 590

N-Acetylglucosamine
NAG15-N	Alpha Diagnostics	1 g	EUR 286

Purified Human beta-2 microglobulin (B2M) protein for ELISA/Standards
B2M15-N	Alpha Diagnostics	50 ug	EUR 286

Haptoglobin 2-2 (Hp2-2), Human Plasma (>95%, 170-900 kda)
HGLB21-N	Alpha Diagnostics	0.5 mg	EUR 286

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

Coelenterazine n
10115-2	Biotium	250uG	EUR 259
Description: Minimum order quantity: 1 unit of 250uG

Pseudomonas putida Creatinine amidohydrolase (crnA)
1-CSB-EP028075FFZ	Cusabio	EUR 611.00 EUR 309.00 EUR 1827.00 EUR 939.00 EUR 1218.00 EUR 397.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 55.6 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Pseudomonas putida Creatinine amidohydrolase(crnA) expressed in E.coli

ASAH2 Polyclonal Antibody, HRP Conjugated
A62107	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

ASAH2 Polyclonal Antibody, FITC Conjugated
A62108	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

ASAH2 Polyclonal Antibody, Biotin Conjugated
A62109	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

Asah2 ORF Vector (Rat) (pORF)
ORF063704	ABM	1.0 ug DNA	EUR 506

Asah2 ORF Vector (Mouse) (pORF)
ORF039138	ABM	1.0 ug DNA	EUR 506

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Acylsphingosine Deacylase 3-Like (ASAH3L) Antibody
20-abx014172	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	100 ug 10 ug 200 ug 300 µg
Shipped within 5-10 working days.

Human Fibrinogen (FBG) AssayMax ELISA Kit
EF1040-2	AssayPro	96 Well Plate	EUR 396

ASAH2 sgRNA CRISPR Lentivector (Human) (Target 1)
K0130502	ABM	1.0 ug DNA	EUR 154

ASAH2 sgRNA CRISPR Lentivector (Human) (Target 3)
K0130504	ABM	1.0 ug DNA	EUR 154

Human ASAH2(N-Acylsphingosine Amidohydrolase 2) ELISA Kit