Human TMPO(Thymopoietin) ELISA Kit

To Order: Contact

Human Thymopoietin (TMPO) ELISA Kit
SEC824Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thymopoietin (TMPO) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thymopoietin (TMPO) in serum, plasma, tissue homogenates and other biological fluids.

Human Thymopoietin (TMPO) ELISA Kit
SEC824Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thymopoietin (TMPO) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thymopoietin (TMPO) in serum, plasma, tissue homogenates and other biological fluids.

Human Thymopoietin (TMPO) ELISA Kit
SEC824Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thymopoietin (TMPO) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thymopoietin (TMPO) in serum, plasma, tissue homogenates and other biological fluids.

Human Thymopoietin (TMPO) ELISA Kit
SEC824Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thymopoietin (TMPO) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thymopoietin (TMPO) in serum, plasma, tissue homogenates and other biological fluids.

Human Thymopoietin (TMPO) ELISA Kit
4-SEC824Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Thymopoietin elisa. Alternative names of the recognized antigen: TP LAP2 CMD1T LEMD4 TP5 Splenin Lamina-Associated Polypeptide 2, Isoforms Beta/Gamma LEM Domain Containing 4 Thymopoietin-related peptide isoforms beta/gamma
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Thymopoietin (TMPO) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Thymopoietin ELISA Kit (TMPO)
RK02407	Abclonal	96 Tests	EUR 521

Human Thymopoietin(TMPO)ELISA Kit
QY-E00760	Qayee Biotechnology	96T	EUR 361

Mouse Thymopoietin (TMPO) ELISA Kit
abx516010-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Rat Thymopoietin (TMPO) ELISA Kit
abx516012-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Mouse Thymopoietin(TMPO)ELISA kit
GA-E0838MS-48T	GenAsia Biotech	48T	EUR 336

Mouse Thymopoietin(TMPO)ELISA kit
GA-E0838MS-96T	GenAsia Biotech	96T	EUR 534

Rat Thymopoietin(TMPO)ELISA kit
QY-E10460	Qayee Biotechnology	96T	EUR 361

Mouse Thymopoietin(TMPO)ELISA kit
QY-E21460	Qayee Biotechnology	96T	EUR 361

Thymopoietin (TMPO) Antibody
20-abx116091	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Thymopoietin (TMPO) Antibody
20-abx131651	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Thymopoietin (TMPO) Antibody
20-abx001974	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Thymopoietin (TMPO) Antibody
20-abx142268	Abbexa	EUR 370.00 EUR 606.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Thymopoietin (TMPO) Antibody
abx030767-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Thymopoietin (TMPO) Antibody
abx030767-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Thymopoietin (TMPO) Antibody
abx028266-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Thymopoietin (TMPO) Antibody
abx028266-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Thymopoietin (TMPO) Antibody
20-abx174779	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Recombinant Thymopoietin (TMPO)
4-RPC824Hu01	Cloud-Clone	EUR 445.86 EUR 222.00 EUR 1396.96 EUR 532.32 EUR 964.64 EUR 361.00 EUR 3342.40	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P42167 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 30.5kDa Isoelectric Point: Inquire
Description: Recombinant Human Thymopoietin expressed in: E.coli

ELISA kit for Human TMPO (Thymopoietin)
ELK4922	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Thymopoietin (TMPO). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Thymopoietin ( Show more
Description: A sandwich ELISA kit for detection of Thymopoietin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Thymopoietin (TMPO) CLIA Kit
20-abx493916	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Thymopoietin (TMPO) Protein
20-abx650199	Abbexa	EUR 620.00 EUR 272.00 EUR 1887.00 EUR 746.00 EUR 453.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Thymopoietin (TMPO) Polyclonal Antibody (Human, Mouse)
4-PAC824Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TMPO (Met1~Leu243) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Thymopoietin (TMPO)

Thymopoietin (TMPO) Polyclonal Antibody (Human, Mouse), APC
4-PAC824Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TMPO (Met1~Leu243) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Thymopoietin (TMPO). This antibody is labeled with APC.

Thymopoietin (TMPO) Polyclonal Antibody (Human, Mouse), Biotinylated
4-PAC824Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TMPO (Met1~Leu243) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Thymopoietin (TMPO). This antibody is labeled with Biotin.

Thymopoietin (TMPO) Polyclonal Antibody (Human, Mouse), Cy3
4-PAC824Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TMPO (Met1~Leu243) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Thymopoietin (TMPO). This antibody is labeled with Cy3.

Thymopoietin (TMPO) Polyclonal Antibody (Human, Mouse), FITC
4-PAC824Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TMPO (Met1~Leu243) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Thymopoietin (TMPO). This antibody is labeled with FITC.

Thymopoietin (TMPO) Polyclonal Antibody (Human, Mouse), HRP
4-PAC824Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TMPO (Met1~Leu243) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Thymopoietin (TMPO). This antibody is labeled with HRP.

Thymopoietin (TMPO) Polyclonal Antibody (Human, Mouse), PE
4-PAC824Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TMPO (Met1~Leu243) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Thymopoietin (TMPO). This antibody is labeled with PE.

Thymopoietin (TMPO) Polyclonal Antibody (Human, Mouse), APC-Cy7
4-PAC824Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TMPO (Met1~Leu243) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Thymopoietin (TMPO). This antibody is labeled with APC-Cy7.

Polyclonal TMPO / TP / Thymopoietin Antibody (N-Terminus)
APR03096G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TMPO / TP / Thymopoietin (N-Terminus). This antibody is tested and proven to work in the following applications:

Human TMPO ELISA KIT
ELI-04132h	Lifescience Market	96 Tests	EUR 824

TMPO ELISA Kit (Human) (OKCD02937)
OKCD02937	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: May help direct the assembly of the nuclear lamina and thereby help maintain the structural organization of the nuclear envelope. Possible receptor for attachment of lamin filaments to the inner nuclear membrane. May be involved in the control of initiation of DNA replication through its interaction with NAKAP95. Thymopoietin (TP) and Thymopentin (TP5) may play a role in T-cell development and function. TP5 is an immunomodulating pentapeptide. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 12.9 pg/mL

TMPO ELISA Kit (Human) (OKEI00289)
OKEI00289	Aviva Systems Biology	96 Wells	EUR 767
Description: Description of target: May be involved in the structural organization of the nucleus and in the post-mitotic nuclear assembly. Plays an important role, together with LMNA, in the nuclear anchorage of RB1. TP and TP5 may play a role in T-cell development and function. TP5 is an immunomodulating pentapeptide. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.938 ng/mL

TMPO / TMPO Antibody
20-abx329779	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

TMPO/TMPO Antibody
1-CSB-PA259190	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against TMPO/TMPO. Recognizes TMPO/TMPO from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-10000, ELISA:1:10000

Mouse Tmpo ELISA KIT
ELI-04131m	Lifescience Market	96 Tests	EUR 865

Mouse Tmpo ELISA KIT
ELI-04134m	Lifescience Market	96 Tests	EUR 865

Thymopoietin antibody
70R-6297	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal Thymopoietin antibody raised against the N terminal of TMPO

Thymopoietin antibody
70R-6298	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal Thymopoietin antibody raised against the middle region of TMPO

Thymopoietin antibody
70R-6387	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal Thymopoietin antibody raised against the N terminal of TMPO

Thymopoietin Antibody
25390-100ul	SAB	100ul	EUR 390

TMPO ELISA Kit (Rat) (OKEH03323)
OKEH03323	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: Binds directly to lamin B1 and chromosomes in a mitotic phosphorylation-regulated manner. May play an important role in nuclear envelope reassembly at the end of mitosis and/or anchoring of the nuclear lamina and interphase chromosomes to the nuclear envelope.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Competitive ELISA;Sensitivity: 0.4 ng/mL

Polyclonal Thymopoietin Antibody
APR06736G	Leading Biology	0.1 mg	EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Thymopoietin . This antibody is tested and proven to work in the following applications:

Thymopoietin Blocking Peptide
33R-6275	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TMPO antibody, catalog no. 70R-6297

Thymopoietin Blocking Peptide
33R-2506	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TMPO antibody, catalog no. 70R-6298

Thymopoietin Blocking Peptide
33R-7041	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TMPO antibody, catalog no. 70R-6387

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

TMPO siRNA
20-abx900018	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TMPO siRNA
20-abx900039	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TMPO siRNA
20-abx937501	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TMPO siRNA
20-abx937502	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TMPO siRNA
20-abx937503	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TMPO antibody
70R-20884	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal TMPO antibody

TMPO Antibody
ABD6994	Lifescience Market	100 ug	EUR 438

TMPO Antibody
32699-100ul	SAB	100ul	EUR 252

TMPO Antibody
DF6994	Affbiotech	200ul	EUR 304
Description: TMPO Antibody detects endogenous levels of total TMPO.

TMPO Antibody
1-CSB-PA023913GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TMPO. Recognizes TMPO from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

anti-TMPO
YF-PA27383	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to TMPO

Human TMPO shRNA Plasmid
20-abx954879	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human TMPO shRNA Plasmid
20-abx954880	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

TMPO Recombinant Protein (Human)
RP032329	ABM	100 ug	Ask for price

TMPO Conjugated Antibody
C32699	SAB	100ul	EUR 397

TMPO cloning plasmid
CSB-CL023913HU-10ug	Cusabio	10ug	EUR 492
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1365 Sequence: atgccggagttcctggaagacccctcggtcctgacaaaagacaagttgaagagtgagttggtcgccaacaatgtgacgctgccggccggggagcagcgcaaagacgtgtacgtccagctctacctgcagcacctcacggctcgcaaccggccgccgctccccgccggcaccaaca Show more
Description: A cloning plasmid for the TMPO gene.

TMPO Polyclonal Antibody
ES8548-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against TMPO from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

TMPO Polyclonal Antibody
ES8548-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against TMPO from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

TMPO Polyclonal Antibody
ABP57555-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthetic peptide from human protein at AA range: 1-50 Applications tips:
Description: A polyclonal antibody for detection of TMPO from Human, Mouse, Rat. This TMPO antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 1-50

TMPO Polyclonal Antibody
ABP57555-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthetic peptide from human protein at AA range: 1-50 Applications tips:
Description: A polyclonal antibody for detection of TMPO from Human, Mouse, Rat. This TMPO antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 1-50

TMPO Polyclonal Antibody
ABP57555-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthetic peptide from human protein at AA range: 1-50 Applications tips:
Description: A polyclonal antibody for detection of TMPO from Human, Mouse, Rat. This TMPO antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 1-50

TMPO Polyclonal Antibody
46756-100ul	SAB	100ul	EUR 252

TMPO Polyclonal Antibody
46756-50ul	SAB	50ul	EUR 187

TMPO Blocking Peptide
DF6994-BP	Affbiotech	1mg	EUR 195

Anti-TMPO antibody
STJ98661	St John's Laboratory	200 µl	EUR 197
Description: TMPO is a protein encoded by the TMPO gene which is approximately 75,4 kDa. TMPO is localised to the nucleus and is involved in the mitotic cell cycle, nuclear envelope reassembly, transport of the SLBP independent mature mRNA and apoptosis. It may be involved in the structural organization of the nucleus and in the post-mitotic nuclear assembly and plays an important role, together with LMNA, in the nuclear anchorage of RB1. It may also be involved in the control of initiation of DNA replication through its interaction with NAKAP95. TMPO is expressed in many tissues and is most abundant in adult thymus and fetal liver. Mutations in the TMPO gene result in dilated cardiomyopathy and dysentery. STJ98661 was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen. This antibody detects endogenous TMPO protein.

Anti-TMPO antibody
STJ25881	St John's Laboratory	100 µl	EUR 413
Description: The protein encoded by this gene resides in the nucleus and may play a role in the assembly of the nuclear lamina, and thus help maintain the structural organization of the nuclear envelope. It may function as a receptor for the attachment of lamin filaments to the inner nuclear membrane. Mutations in this gene are associated with dilated cardiomyopathy. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene.

TMPO ORF Vector (Human) (pORF)
ORF010777	ABM	1.0 ug DNA	EUR 95

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

Rat TMPO shRNA Plasmid
20-abx984957	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Anti-TMPO/Lap2 Antibody
A03278	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for TMPO Antibody (TMPO) detection.tested for IHC, WB in Human, Mouse, Rat.

Mouse TMPO shRNA Plasmid
20-abx973144	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse TMPO shRNA Plasmid
20-abx973145	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

TMPO Recombinant Protein (Rat)
RP233936	ABM	100 ug	Ask for price

TMPO Recombinant Protein (Mouse)
RP180017	ABM	100 ug	Ask for price

TMPO Recombinant Protein (Mouse)
RP180020	ABM	100 ug	Ask for price

TMPO Recombinant Protein (Mouse)
RP180023	ABM	100 ug	Ask for price

TMPO Recombinant Protein (Mouse)
RP180026	ABM	100 ug	Ask for price

TMPO Recombinant Protein (Mouse)
RP180029	ABM	100 ug	Ask for price

TMPO Recombinant Protein (Mouse)
RP180032	ABM	100 ug	Ask for price

TMPO sgRNA CRISPR Lentivector set (Human)
K2409901	ABM	3 x 1.0 ug	EUR 339

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

Human TMPO/ Lamina-associated polypeptide 2, isoforms beta/gamma ELISA Kit
E2522Hu	Sunlong	1 Kit	EUR 571

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV205PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV220PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV225PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS750A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS770A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS790A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
CAS9LIG-KIT	SBI	1 Kit	EUR 153
Category: Cas9

[KO Validated] TMPO Rabbit pAb
A2534-100ul	Abclonal	100 ul	EUR 410

[KO Validated] TMPO Rabbit pAb
A2534-200ul	Abclonal	200 ul	EUR 571

[KO Validated] TMPO Rabbit pAb
A2534-20ul	Abclonal	20 ul	EUR 221

[KO Validated] TMPO Rabbit pAb
A2534-50ul	Abclonal	50 ul	EUR 287

Tmpo ORF Vector (Mouse) (pORF)
ORF060007	ABM	1.0 ug DNA	EUR 506

Tmpo ORF Vector (Mouse) (pORF)
ORF060008	ABM	1.0 ug DNA	EUR 506

Tmpo ORF Vector (Mouse) (pORF)
ORF060009	ABM	1.0 ug DNA	EUR 506

Tmpo ORF Vector (Mouse) (pORF)
ORF060010	ABM	1.0 ug DNA	EUR 506

Tmpo ORF Vector (Mouse) (pORF)
ORF060011	ABM	1.0 ug DNA	EUR 506

Tmpo ORF Vector (Mouse) (pORF)
ORF060012	ABM	1.0 ug DNA	EUR 506

Tmpo ORF Vector (Rat) (pORF)
ORF077980	ABM	1.0 ug DNA	EUR 506

pECMV-Tmpo-m-FLAG Plasmid
PVT14942	Lifescience Market	2 ug	EUR 325

TMPO sgRNA CRISPR Lentivector (Human) (Target 1)
K2409902	ABM	1.0 ug DNA	EUR 154

TMPO sgRNA CRISPR Lentivector (Human) (Target 2)
K2409903	ABM	1.0 ug DNA	EUR 154

TMPO sgRNA CRISPR Lentivector (Human) (Target 3)
K2409904	ABM	1.0 ug DNA	EUR 154

TMPO Protein Vector (Human) (pPB-C-His)
PV043105	ABM	500 ng	EUR 329

TMPO Protein Vector (Human) (pPB-N-His)
PV043106	ABM	500 ng	EUR 329

TMPO Protein Vector (Human) (pPM-C-HA)
PV043107	ABM	500 ng	EUR 329

TMPO Protein Vector (Human) (pPM-C-His)
PV043108	ABM	500 ng	EUR 329

Rat Tmpo/ Lamina-associated polypeptide 2, isoform beta ELISA Kit
E0983Ra	Sunlong	1 Kit	EUR 571

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE620A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE622A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE624A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

ELISA kit for Mouse Lamina-associated polypeptide 2, isoform alpha (TMPO)
KTE70153-48T	Abbkine	48T	EUR 332
Thymopoietin is a protein involved in the induction of CD90 in the thymus. The thymopoetin (TMPO) gene encodes three alternatively spliced mRNAs encoding proteins of 75 kDa (alpha), 51 kDa (beta) and 39 kDa (gamma) which are ubiquitously expressed in Show more
Description: Quantitative sandwich ELISA for measuring Mouse Lamina-associated polypeptide 2, isoform alpha (TMPO) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Lamina-associated polypeptide 2, isoform alpha (TMPO)
KTE70153-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Thymopoietin is a protein involved in the induction of CD90 in the thymus. The thymopoetin (TMPO) gene encodes three alternatively spliced mRNAs encoding proteins of 75 kDa (alpha), 51 kDa (beta) and 39 kDa (gamma) which are ubiquitously expressed in Show more
Description: Quantitative sandwich ELISA for measuring Mouse Lamina-associated polypeptide 2, isoform alpha (TMPO) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Lamina-associated polypeptide 2, isoform alpha (TMPO)
KTE70153-96T	Abbkine	96T	EUR 539
Thymopoietin is a protein involved in the induction of CD90 in the thymus. The thymopoetin (TMPO) gene encodes three alternatively spliced mRNAs encoding proteins of 75 kDa (alpha), 51 kDa (beta) and 39 kDa (gamma) which are ubiquitously expressed in Show more
Description: Quantitative sandwich ELISA for measuring Mouse Lamina-associated polypeptide 2, isoform alpha (TMPO) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Tmpo sgRNA CRISPR Lentivector set (Mouse)
K4483401	ABM	3 x 1.0 ug	EUR 339

Tmpo sgRNA CRISPR Lentivector set (Rat)
K6772801	ABM	3 x 1.0 ug	EUR 339

vWF Acty. Kit
ABP-ACT-KIT	Abpcorp	12 x 8 microwells	EUR 428

vWF Ant. Kit
ABP-TOT-KIT	Abpcorp	12 x 8 microwells	EUR 394

hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9)
CAS620A-KIT	SBI	1 kit	EUR 2152
Category: Cas9
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression)

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

PrecisionX Multiplex gRNA Cloning Kit
CAS9-GRNA-KIT	SBI	10 rxn	EUR 445
Category: Cas9

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1	SBI	25 ul each	EUR 627
Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1	SBI	5 reactions	EUR 1152
Category: Stem Cell Products

Tmpo sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4483402	ABM	1.0 ug DNA	EUR 154

Tmpo sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4483403	ABM	1.0 ug DNA	EUR 154

Tmpo sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4483404	ABM	1.0 ug DNA	EUR 154

Tmpo sgRNA CRISPR Lentivector (Rat) (Target 1)
K6772802	ABM	1.0 ug DNA	EUR 154

Tmpo sgRNA CRISPR Lentivector (Rat) (Target 2)
K6772803	ABM	1.0 ug DNA	EUR 154

Tmpo sgRNA CRISPR Lentivector (Rat) (Target 3)
K6772804	ABM	1.0 ug DNA	EUR 154

TMPO Protein Vector (Rat) (pPB-C-His)
PV311918	ABM	500 ng	EUR 603

TMPO Protein Vector (Rat) (pPB-N-His)
PV311919	ABM	500 ng	EUR 603

TMPO Protein Vector (Rat) (pPM-C-HA)
PV311920	ABM	500 ng	EUR 603

TMPO Protein Vector (Rat) (pPM-C-His)
PV311921	ABM	500 ng	EUR 603

TMPO Protein Vector (Mouse) (pPB-C-His)
PV240026	ABM	500 ng	EUR 1065

TMPO Protein Vector (Mouse) (pPB-N-His)
PV240027	ABM	500 ng	EUR 1065

TMPO Protein Vector (Mouse) (pPM-C-HA)
PV240028	ABM	500 ng	EUR 1065

TMPO Protein Vector (Mouse) (pPM-C-His)
PV240029	ABM	500 ng	EUR 1065

TMPO Protein Vector (Mouse) (pPB-C-His)
PV240030	ABM	500 ng	EUR 603

TMPO Protein Vector (Mouse) (pPB-N-His)
PV240031	ABM	500 ng	EUR 603

TMPO Protein Vector (Mouse) (pPM-C-HA)
PV240032	ABM	500 ng	EUR 603

TMPO Protein Vector (Mouse) (pPM-C-His)
PV240033	ABM	500 ng	EUR 603

TMPO Protein Vector (Mouse) (pPB-C-His)
PV240034	ABM	500 ng	EUR 603

TMPO Protein Vector (Mouse) (pPB-N-His)
PV240035	ABM	500 ng	EUR 603

TMPO Protein Vector (Mouse) (pPM-C-HA)
PV240036	ABM	500 ng	EUR 603

TMPO Protein Vector (Mouse) (pPM-C-His)
PV240037	ABM	500 ng	EUR 603

TMPO Protein Vector (Mouse) (pPB-C-His)
PV240038	ABM	500 ng	EUR 603

TMPO Protein Vector (Mouse) (pPB-N-His)
PV240039	ABM	500 ng	EUR 603

TMPO Protein Vector (Mouse) (pPM-C-HA)
PV240040	ABM	500 ng	EUR 603

TMPO Protein Vector (Mouse) (pPM-C-His)
PV240041	ABM	500 ng	EUR 603

TMPO Protein Vector (Mouse) (pPB-C-His)
PV240042	ABM	500 ng	EUR 603

TMPO Protein Vector (Mouse) (pPB-N-His)
PV240043	ABM	500 ng	EUR 603

TMPO Protein Vector (Mouse) (pPM-C-HA)
PV240044	ABM	500 ng	EUR 603

TMPO Protein Vector (Mouse) (pPM-C-His)
PV240045	ABM	500 ng	EUR 603

TMPO Protein Vector (Mouse) (pPB-C-His)
PV240046	ABM	500 ng	EUR 603

TMPO Protein Vector (Mouse) (pPB-N-His)
PV240047	ABM	500 ng	EUR 603

TMPO Protein Vector (Mouse) (pPM-C-HA)
PV240048	ABM	500 ng	EUR 603

TMPO Protein Vector (Mouse) (pPM-C-His)
PV240049	ABM	500 ng	EUR 603

Tmpo 3'UTR GFP Stable Cell Line
TU170829	ABM	1.0 ml	Ask for price

TMPO 3'UTR GFP Stable Cell Line
TU075957	ABM	1.0 ml	EUR 1394

Tmpo 3'UTR Luciferase Stable Cell Line
TU120829	ABM	1.0 ml	Ask for price

TMPO 3'UTR Luciferase Stable Cell Line
TU025957	ABM	1.0 ml	EUR 1394

Tmpo 3'UTR Luciferase Stable Cell Line
TU222191	ABM	1.0 ml	Ask for price

Tmpo 3'UTR GFP Stable Cell Line
TU272191	ABM	1.0 ml	Ask for price

Rat Lamina- associated polypeptide 2, isoform beta, Tmpo ELISA K
ELI-04133r	Lifescience Market	96 Tests	EUR 886

TMPO sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2409905	ABM	3 x 1.0 ug	EUR 376

TMPO Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV671011	ABM	1.0 ug DNA	EUR 682

TMPO Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV671015	ABM	1.0 ug DNA	EUR 682

TMPO Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV671016	ABM	1.0 ug DNA	EUR 682

CLOuD9 Gene Expression Regulation Kit (includes 10 ug each of dCas9-PYL1 and dCas9-ABI1 lentivectors, and 100 ul of 0.5M Inducer Agent)
CASCL9-100A-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

TMPO sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K2409906	ABM	1.0 ug DNA	EUR 167

TMPO sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K2409907	ABM	1.0 ug DNA	EUR 167

TMPO sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K2409908	ABM	1.0 ug DNA	EUR 167

Tmpo sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4483405	ABM	3 x 1.0 ug	EUR 376

Tmpo sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6772805	ABM	3 x 1.0 ug	EUR 376

AXYGEN® AXYPET® PRO STARTER KIT: 4 PIPETTORS, PLEXI STAND, SAMPLE TIPS
AP-STR-KIT-P	CORNING	1/pk	EUR 721
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Tmpo sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K4483406	ABM	1.0 ug DNA	EUR 167

Tmpo sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K4483407	ABM	1.0 ug DNA	EUR 167

Tmpo sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K4483408	ABM	1.0 ug DNA	EUR 167

TMPO Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV671012	ABM	1.0 ug DNA	EUR 682

TMPO Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV671013	ABM	1.0 ug DNA	EUR 740

TMPO Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV671014	ABM	1.0 ug DNA	EUR 740

Tmpo sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K6772806	ABM	1.0 ug DNA	EUR 167

Tmpo sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K6772807	ABM	1.0 ug DNA	EUR 167

Tmpo sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K6772808	ABM	1.0 ug DNA	EUR 167

AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-1	CORNING	1/pk	EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-2	CORNING	1/pk	EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Human Kit ELISA Kit
ELA-E0121h	Lifescience Market	96 Tests	EUR 824

Human KIT/SCFR ELISA kit
LF-EK50791	Abfrontier	1×96T	EUR 648

KIT ELISA Kit (Human) (OKAN04574)
OKAN04574	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: This gene encodes the human homolog of the proto-oncogene c-kit. C-kit was first identified as the cellular homolog of the feline sarcoma viral oncogene v-kit. This protein is a type 3 transmembrane receptor for MGF (mast cell growth factor, also known as stem cell factor). Mutations in this gene are associated with gastrointestinal stromal tumors, mast cell disease, acute myelogenous lukemia, and piebaldism. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.61 ng/mL

KIT ELISA Kit (Human) (OKCD06003)
OKCD06003	Aviva Systems Biology	96 Wells	EUR 648
Description: Description of target: This gene encodes the human homolog of the proto-oncogene c-kit. C-kit was first identified as the cellular homolog of the feline sarcoma viral oncogene v-kit. This protein is a type 3 transmembrane receptor for MGF (mast cell growth factor, also known as stem cell factor). Mutations in this gene are associated with gastrointestinal stromal tumors, mast cell disease, acute myelogenous lukemia, and piebaldism. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.61ng/mL

Human Biopterin ELISA Kit
CELI-66011h	Lifescience Market	96 Tests	EUR 824

Human lipopolysaccharides ELISA Kit
CELI-66031h	Lifescience Market	96 Tests	EUR 824

Human Microlbumin ELISA Kit
abx517025-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Trypsin ELISA kit
E01T0139-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Trypsin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Trypsin ELISA kit
E01T0139-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Trypsin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Trypsin ELISA kit
E01T0139-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Trypsin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tryptophane ELISA kit
E01T0140-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Tryptophane in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tryptophane ELISA kit
E01T0140-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Tryptophane in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tryptophane ELISA kit
E01T0140-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Tryptophane in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thyroglobulin ELISA kit
E01T0141-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Thyroglobulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thyroglobulin ELISA kit
E01T0141-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Thyroglobulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thyroglobulin ELISA kit
E01T0141-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Thyroglobulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Talin ELISA kit
E01T0222-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Talin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Talin ELISA kit
E01T0222-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Talin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Talin ELISA kit
E01T0222-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Talin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thrombomodulin ELISA kit
E01T0229-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Thrombomodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thrombomodulin ELISA kit
E01T0229-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Thrombomodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thrombomodulin ELISA kit
E01T0229-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Thrombomodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thioredoxin ELISA kit
E01T0336-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Thioredoxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human TMPO(Thymopoietin) ELISA Kit