Human RLBP1(Retinaldehyde Binding Protein 1) ELISA Kit

To Order: Contact

Human Retinaldehyde Binding Protein 1 (RLBP1) ELISA Kit

SEC776Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Retinaldehyde Binding Protein 1 (RLBP1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Ass
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Retinaldehyde Binding Protein 1 (RLBP1) in Tissue homogenates, cell lysates and other biological fluids.

Human Retinaldehyde Binding Protein 1 (RLBP1) ELISA Kit

SEC776Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Retinaldehyde Binding Protein 1 (RLBP1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Ass
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Retinaldehyde Binding Protein 1 (RLBP1) in Tissue homogenates, cell lysates and other biological fluids.

Human Retinaldehyde Binding Protein 1 (RLBP1) ELISA Kit

SEC776Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Retinaldehyde Binding Protein 1 (RLBP1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Ass
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Retinaldehyde Binding Protein 1 (RLBP1) in Tissue homogenates, cell lysates and other biological fluids.

Human Retinaldehyde Binding Protein 1 (RLBP1) ELISA Kit

4-SEC776Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Retinaldehyde Binding Protein 1 elisa. Alternative names of the recognized antigen: CRALBP
  • Cellular retinaldehyde-binding protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Retinaldehyde Binding Protein 1 (RLBP1) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Retinaldehyde Binding Protein 1 (RLBP1) Protein

20-abx166052
  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Retinaldehyde Binding Protein 1 (RLBP1) Antibody

20-abx115142
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Retinaldehyde-Binding Protein 1 (RLBP1) Antibody

20-abx123658
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Retinaldehyde Binding Protein 1 (RLBP1) Antibody

20-abx128205
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Retinaldehyde-Binding Protein 1 (RLBP1) Antibody

abx145086-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Retinaldehyde Binding Protein 1 (RLBP1) Antibody

20-abx174386
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Retinaldehyde-Binding Protein 1 (RLBP1) Antibody

abx237318-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Retinaldehyde Binding Protein 1 (RLBP1) Antibody

20-abx333900
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Recombinant Retinaldehyde Binding Protein 1 (RLBP1)

4-RPC776Hu01
  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P12271
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 40.2kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Retinaldehyde Binding Protein 1 expressed in: E.coli

Mouse Retinaldehyde-binding protein 1 (RLBP1) ELISA Kit

abx390444-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Bovine Retinaldehyde- binding protein 1, RLBP1 ELISA KIT

ELI-35778b 96 Tests
EUR 928

Mouse Retinaldehyde- binding protein 1, Rlbp1 ELISA KIT

ELI-41139m 96 Tests
EUR 865

Human Retinaldehyde-Binding Protein 1 (RLBP1) Antibody

32137-05111 150 ug
EUR 261

Human Retinaldehyde Binding Protein 1 (RLBP1) CLIA Kit

20-abx493896
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human RLBP1 (Retinaldehyde Binding Protein 1)

ELK5093 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Retinaldehyde Binding Protein 1 (RLBP1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specif
  • Show more
Description: A sandwich ELISA kit for detection of Retinaldehyde Binding Protein 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Retinaldehyde-binding protein 1 (RLBP1)

KTE60792-48T 48T
EUR 354
Description: Quantitative sandwich ELISA for measuring Human Retinaldehyde-binding protein 1 (RLBP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Retinaldehyde-binding protein 1 (RLBP1)

KTE60792-5platesof96wells 5 plates of 96 wells
EUR 2252
Description: Quantitative sandwich ELISA for measuring Human Retinaldehyde-binding protein 1 (RLBP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Retinaldehyde-binding protein 1 (RLBP1)

KTE60792-96T 96T
EUR 572
Description: Quantitative sandwich ELISA for measuring Human Retinaldehyde-binding protein 1 (RLBP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

RLBP1 Retinaldehyde Binding Protein 1 Human Recombinant Protein

PROTP12271 Regular: 20ug
EUR 317
Description: RLBP1 Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 340 amino acids (1-317) and having a molecular mass of 38.9 kDa. RLBP1 is fused to a 23 amino acid His-tag at N-terminus.

Retinaldehyde Binding Protein 1 (RLBP1) Antibody (HRP)

20-abx337468
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Retinaldehyde Binding Protein 1 (RLBP1) Antibody (FITC)

20-abx337469
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Retinaldehyde Binding Protein 1 (RLBP1) Antibody (Biotin)

20-abx337470
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Rlbp1 ELISA Kit| Mouse Retinaldehyde-binding protein 1 ELISA Ki

EF016086 96 Tests
EUR 689

RLBP1 ELISA Kit| Bovine Retinaldehyde-binding protein 1 ELISA K

EF011856 96 Tests
EUR 689

Human Retinaldehyde-Binding Protein 1 (RLBP1) Antibody (Biotin Conjugate)

32137-05121 150 ug
EUR 369

Human Retinaldehyde-Binding Protein 1 (RLBP1) AssayLite Antibody (FITC Conjugate)

32137-05141 150 ug
EUR 428

Human Retinaldehyde-Binding Protein 1 (RLBP1) AssayLite Antibody (RPE Conjugate)

32137-05151 150 ug
EUR 428

Human Retinaldehyde-Binding Protein 1 (RLBP1) AssayLite Antibody (APC Conjugate)

32137-05161 150 ug
EUR 428

Human Retinaldehyde-Binding Protein 1 (RLBP1) AssayLite Antibody (PerCP Conjugate)

32137-05171 150 ug
EUR 471

Retinaldehyde Binding Protein 1 (RLBP1) Polyclonal Antibody (Human, Mouse, Pig)

4-PAC776Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RLBP1 (Met1~ Phe317)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Retinaldehyde Binding Protein 1 (RLBP1)

Retinaldehyde Binding Protein 1 (RLBP1) Polyclonal Antibody (Human, Mouse, Pig), APC

4-PAC776Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RLBP1 (Met1~ Phe317)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Retinaldehyde Binding Protein 1 (RLBP1). This antibody is labeled with APC.

Retinaldehyde Binding Protein 1 (RLBP1) Polyclonal Antibody (Human, Mouse, Pig), Biotinylated

4-PAC776Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RLBP1 (Met1~ Phe317)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Retinaldehyde Binding Protein 1 (RLBP1). This antibody is labeled with Biotin.

Retinaldehyde Binding Protein 1 (RLBP1) Polyclonal Antibody (Human, Mouse, Pig), Cy3

4-PAC776Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RLBP1 (Met1~ Phe317)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Retinaldehyde Binding Protein 1 (RLBP1). This antibody is labeled with Cy3.

Retinaldehyde Binding Protein 1 (RLBP1) Polyclonal Antibody (Human, Mouse, Pig), FITC

4-PAC776Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RLBP1 (Met1~ Phe317)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Retinaldehyde Binding Protein 1 (RLBP1). This antibody is labeled with FITC.

Retinaldehyde Binding Protein 1 (RLBP1) Polyclonal Antibody (Human, Mouse, Pig), HRP

4-PAC776Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RLBP1 (Met1~ Phe317)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Retinaldehyde Binding Protein 1 (RLBP1). This antibody is labeled with HRP.

Retinaldehyde Binding Protein 1 (RLBP1) Polyclonal Antibody (Human, Mouse, Pig), PE

4-PAC776Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RLBP1 (Met1~ Phe317)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Retinaldehyde Binding Protein 1 (RLBP1). This antibody is labeled with PE.

Retinaldehyde Binding Protein 1 (RLBP1) Polyclonal Antibody (Human, Mouse, Pig), APC-Cy7

4-PAC776Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RLBP1 (Met1~ Phe317)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Retinaldehyde Binding Protein 1 (RLBP1). This antibody is labeled with APC-Cy7.

Retinaldehyde Binding Protein 1 Protein

20-abx261256
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Retinaldehyde Binding Protein 1-Like 2 Antibody

20-abx115143
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

RLBP1 ELISA KIT|Human

EF002485 96 Tests
EUR 689

RLBP1 ELISA Kit (Human) (OKCD00687)

OKCD00687 96 Wells
EUR 831
Description: Description of target: Soluble retinoid carrier essential the proper function of both rod and cone photoreceptors. Participates in the regeneration of active 11-cis-retinol and 11-cis-retinaldehyde, from the inactive 11-trans products of the rhodopsin photocycle and in the de novo synthesis of these retinoids from 11-trans metabolic precursors. The cycling of retinoids between photoreceptor and adjacent pigment epithelium cells is known as the 'visual cycle'.1 Publication <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.8"Bothnia dystrophy is caused by domino-like rearrangements in cellular retinaldehyde-binding protein mutant R234W."_x005F_x005F_x000D_He X., Lobsiger J., Stocker A._x005F_x005F_x000D_Proc. Natl. Acad. Sci. U.S.A. 106:18545-18550(2009) [PubMed] [Europe PMC] [Abstract]Cited for: X-RAY CRYSTALLOGRAPHY (1.69 ANGSTROMS) OF 2-317 OF WILD-TYPE AND MUTANT TRP-234 IN COMPLEX WITH 11-CIS-RETINAL, FUNCTION, TISSUE SPECIFICITY, RETINAL-BINDING SITES. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.54 ng/mL

RLBP1 Recombinant Protein (Human)

RP026491 100 ug Ask for price

Human Retinol-Binding Protein (RBP) AssayMax ELISA Kit

ER1005-1 96 Well Plate
EUR 417

Human Retinol-Binding Protein (RBP) AssayMax ELISA Kit

ER2005-1 96 Well Plate
EUR 396

Human Complement C4-Binding Protein (C4BP) AssayMax ELISA Kit

EC2202-1 96 Well Plate
EUR 417

Human Retinol-Binding Protein 4 (RBP4) AssayMax ELISA Kit

ER3005-1 96 Well Plate
EUR 396

RLBP1 antibody

70R-19906 50 ul
EUR 435
Description: Rabbit polyclonal RLBP1 antibody

RLBP1 antibody

10R-5629 100 ul
EUR 691
Description: Mouse monoclonal RLBP1 antibody

RLBP1 antibody

10R-5630 100 ul
EUR 691
Description: Mouse monoclonal RLBP1 antibody

RLBP1 antibody

10R-5632 100 ul
EUR 691
Description: Mouse monoclonal RLBP1 antibody

RLBP1 antibody

10R-7148 100 ul
EUR 726
Description: Mouse monoclonal RLBP1 antibody

RLBP1 Antibody

DF12466 200ul
EUR 304
Description: RLBP1 antibody detects endogenous levels of RLBP1.

RLBP1 Antibody

1-CSB-PA019743GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RLBP1. Recognizes RLBP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

RLBP1 Antibody

1-CSB-PA019743LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RLBP1. Recognizes RLBP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

RLBP1 siRNA

20-abx931581
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RLBP1 siRNA

20-abx931582
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ULBP1 Human, UL16 Binding Protein 1 Human Recombinant Protein, Sf9

PROTQ9BZM6-1 Regular: 10ug
EUR 317
Description: ULBP1 Human Recombinant produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 200 amino acids (26-216) and having a molecular mass of 23.4kDa (Molecular size on SDS-PAGE will appear at approximately 20-40kDa).;ULBP1 is fused to a 6 amino acid IgG His-Tag at C-terminus and purified by proprietary chromatographic techniques.

Human Fatty Acid-Binding Protein 4 (FABP4) AssayMax ELISA Kit

EF2702-1 96 Well Plate
EUR 417

Human Fatty Acid-Binding Protein 5 (FABP5) AssayMax ELISA Kit

EF2705-1 96 Well Plate
EUR 417

FABP1 Fatty Acid Binding Protein-1 Human Recombinant Protein

PROTP07148-1 Regular: 10ug
EUR 317
Description: FABP1 Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 127 amino acids and having a total molecular mass of 14.2kDa (calculated).

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

RLBP1 protein (His tag)

80R-3655 100 ug
EUR 327
Description: Purified recombinant RLBP1 protein (His tag)

RLBP1 Recombinant Protein (Mouse)

RP168314 100 ug Ask for price

RLBP1 Recombinant Protein (Mouse)

RP168317 100 ug Ask for price

RLBP1 Recombinant Protein (Rat)

RP226190 100 ug Ask for price

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Human RLBP1 shRNA Plasmid

20-abx954083
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human Gc-Globulin (Vitamin D-binding Protein, DBP) AssayMax ELISA Kit

EG3801-1 96 Well Plate
EUR 396

Human Gc-Globulin (Vitamin D-binding Protein, DBP) AssayMax ELISA Kit

EG3811-1 96 Well Plate
EUR 417

Canine Retinol-Binding Protein 4 (RBP4) AssayMax ELISA Kit

ECR3005-1 96 Well Plate
EUR 396

Mouse Retinol-Binding Protein 4 (RBP4) AssayMax ELISA Kit

EMR3005-1 96 Well Plate
EUR 417

RLBP1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1826602 1.0 ug DNA
EUR 154

RLBP1 Polyclonal Antibody

31667-100ul 100ul
EUR 252

RLBP1 Polyclonal Antibody

31667-50ul 50ul
EUR 187

RLBP1 Blocking Peptide

DF12466-BP 1mg
EUR 195

RLBP1 cloning plasmid

CSB-CL019743HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 954
  • Sequence: atgtcagaaggggtgggcacgttccgcatggtacctgaagaggaacaggagctccgtgcccaactggagcagctcacaaccaaggaccatggacctgtctttggcccgtgcagccagctgccccgccacaccttgcagaaggccaaggatgagctgaacgagagagaggagacccg
  • Show more
Description: A cloning plasmid for the RLBP1 gene.

RLBP1 Rabbit pAb

A9094-100ul 100 ul
EUR 308

RLBP1 Rabbit pAb

A9094-200ul 200 ul
EUR 459

RLBP1 Rabbit pAb

A9094-20ul 20 ul
EUR 183

RLBP1 Rabbit pAb

A9094-50ul 50 ul
EUR 223

anti- RLBP1 antibody

FNab07318 100µg
EUR 548.75
  • Immunogen: retinaldehyde binding protein 1
  • Uniprot ID: P12271
  • Gene ID: 6017
  • Research Area: Neuroscience
Description: Antibody raised against RLBP1

Anti-RLBP1 antibody

PAab07318 100 ug
EUR 386

Anti-RLBP1 antibody

STJ111562 100 µl
EUR 277
Description: The protein encoded by this gene is a 36-kD water-soluble protein which carries 11-cis-retinaldehyde or 11-cis-retinal as physiologic ligands. It may be a functional component of the visual cycle. Mutations of this gene have been associated with severe rod-cone dystrophy, Bothnia dystrophy (nonsyndromic autosomal recessive retinitis pigmentosa) and retinitis punctata albescens.

AZGP1 Alpha-2-Glycoprotein 1 Zinc-Binding Human Recombinant Protein

PROTP25311-1 Regular: 20ug
EUR 317
Description: AZGP1 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 301 amino acids (21-298 a.a) and having a molecular mass of 34.5kDa.;AZGP1 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

TARDBP (1-414) Human, TAR DNA Binding Protein (1-414 a.a.) Human Recombinant Protein, His Tag

PROTQ13148-1 Regular: 20ug
EUR 317
Description: TARDBP Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 450 amino acids (1-414 a.a) and having a total molecular mass of 48.8 kDa. TARDBP is fused to a 36 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

Human TANK-binding kinase 1-binding protein 1 (TBKBP1) ELISA Kit

abx385467-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human KRAB-associated Protein 1 (KAP-1) AssayMax ELISA Kit

EK2802-1 96 Well Plate
EUR 477

Human Calcineurin Binding Protein 1 ELISA kit

E01C0536-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Calcineurin Binding Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Calcineurin Binding Protein 1 ELISA kit

E01C0536-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Calcineurin Binding Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Calcineurin Binding Protein 1 ELISA kit

E01C0536-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Calcineurin Binding Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human GATA Binding Protein 1 ELISA kit

E01G0084-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human GATA Binding Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human GATA Binding Protein 1 ELISA kit

E01G0084-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human GATA Binding Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human GATA Binding Protein 1 ELISA kit

E01G0084-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human GATA Binding Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human UL16 Binding protein 1 ELISA kit

E01U0022-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human UL16 Binding protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human UL16 Binding protein 1 ELISA kit

E01U0022-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human UL16 Binding protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human UL16 Binding protein 1 ELISA kit

E01U0022-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human UL16 Binding protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Hyaluronan Binding Protein 1 ELISA kit

E01H0035-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Hyaluronan Binding Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Hyaluronan Binding Protein 1 ELISA kit

E01H0035-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Hyaluronan Binding Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Hyaluronan Binding Protein 1 ELISA kit

E01H0035-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Hyaluronan Binding Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

RLBP1 ORF Vector (Human) (pORF)

ORF008831 1.0 ug DNA
EUR 95

RLBP1 Protein Vector (Human) (pPB-C-His)

PV035321 500 ng
EUR 329

RLBP1 Protein Vector (Human) (pPB-N-His)

PV035322 500 ng
EUR 329

RLBP1 Protein Vector (Human) (pPM-C-HA)

PV035323 500 ng
EUR 329

RLBP1 Protein Vector (Human) (pPM-C-His)

PV035324 500 ng
EUR 329

Recombinant Human RLBP1 Protein, His, E.coli-10ug

QP13321-HIS-10ug 10ug
EUR 201

Recombinant Human RLBP1 Protein, His, E.coli-20ug

QP13321-HIS-20ug 20ug
EUR 201

Recombinant Human RLBP1 Protein, His, E.coli-2ug

QP13321-HIS-2ug 2ug
EUR 155

Recombinant Human RLBP1 Protein, His, E.coli-5ug

QP13321-HIS-5ug 5ug
EUR 155

Recombinant Human RLBP1 Protein, His, E.coli-1mg

QP13321-HIS-EC-1mg 1mg
EUR 2757

Recombinant Human RLBP1 Protein, His, Insect-1mg

QP13321-HIS-INSECT-1mg 1mg
EUR 5251

ULBP4 UL16 Binding Protein 4 Human Recombinant Protein

PROTQ8TD07-1 Regular: 10ug
EUR 317
Description: ULBP4 Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain (Isoform 3 of Q8TD07) containing 192 amino acids including a 10 aa His tag at N-terminus. The total calculated molecular mass is 22kDa.

AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS

AP-STR-KIT-1 1/pk
EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Human Heat Shock Factor Protein 1 (HSF 1) AssayMax ELISA kit

EH5215-1 96 Well Plate
EUR 417

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

ULBP2 Human, UL16 Binding Protein 2 Human Recombinant Protein, Sf9

PROTQ9BZM5-1 Regular: 10ug
EUR 317
Description: ULBP2 Human Recombinant produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 200 amino acids (26-216a.a) and having a molecular mass of 22.7kDa (Molecular size on SDS-PAGE will appear at approximately 28-40kDa). ULBP2 is fused to a 9 amino acid His-tag at C-terminus & purified by proprietary chromatographic techniques.

IL18BP Human, Interleukin-18 Binding Protein Human Recombinant Protein, Sf9

PROTO95998-1 Regular: 10ug
EUR 317
Description: IL18BP Human Recombinant produced in Sf9 Baculovirus cells is a single, non-glycosylated polypeptide chain containing 406 amino acids (31-194a.a) and having a molecular mass of 44.9kDa. (Molecular size on SDS-PAGE will appear at approximately 40-57kDa). IL18BP is fused to a 239 amino acid hIgG-His-tag at C-terminus & purified by proprietary chromatographic techniques.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Human Hexokinase-1 AssayMax ELISA Kit

EH3101-1 96 Well Plate
EUR 477

Human Complexin-1 AssayMax ELISA Kit

EC3505-1 96 Well Plate
EUR 417

Human Glutaredoxin-1 AssayMax ELISA Kit

EG2153-1 96 Well Plate
EUR 417

S100b S100 Calcium Binding Protein B Human Recombinant Protein

PROTP04271-1 Regular: 20ug
EUR 317
Description: S100b Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 92 amino acids (1-92 a.a.) and having a molecular mass of 10.7kDa.; The S100b is purified by proprietary chromatographic techniques.

S100A8 S100 Calcium Binding Protein A8 Human Recombinant Protein

PROTP05109-1 Regular: 20ug
EUR 317
Description: S100A8 Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 93 amino acids (1-93 a.a.) and having a molecular mass of 10.8 kDa. The S100A8 is purified by proprietary chromatographic techniques.

FABP2 Fatty Acid Binding Protein-2 Human Recombinant Protein

PROTP12104-1 Regular: 25ug
EUR 317
Description: FABP2 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 131 amino acids and having a molecular mass of 15.1kDa.;The FABP2 is purified by proprietary chromatographic techniques.

Mouse RLBP1 shRNA Plasmid

20-abx972464
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RLBP1 Polyclonal Conjugated Antibody

C31667 100ul
EUR 397

RLBP1 Antibody, HRP conjugated

1-CSB-PA019743LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RLBP1. Recognizes RLBP1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RLBP1 Antibody, FITC conjugated

1-CSB-PA019743LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RLBP1. Recognizes RLBP1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RLBP1 Antibody, Biotin conjugated

1-CSB-PA019743LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RLBP1. Recognizes RLBP1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Human RalA Binding Protein 1 (RALBP1)ELISA Kit

201-12-2410 96 tests
EUR 440
  • This RalA Binding Protein 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human AE Binding Protein 1 (AEBP1)ELISA Kit

201-12-2821 96 tests
EUR 440
  • This AE Binding Protein 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human AE Binding Protein 1 (AEBP1) ELISA Kit

DLR-AEBP1-Hu-48T 48T
EUR 517
  • Should the Human AE Binding Protein 1 (AEBP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human AE Binding Protein 1 (AEBP1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human AE Binding Protein 1 (AEBP1) ELISA Kit

DLR-AEBP1-Hu-96T 96T
EUR 673
  • Should the Human AE Binding Protein 1 (AEBP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human AE Binding Protein 1 (AEBP1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Phosphatidylethanolamine Binding Protein 1 (PEBP1) ELISA Kit

DLR-PEBP1-Hu-48T 48T
EUR 517
  • Should the Human Phosphatidylethanolamine Binding Protein 1 (PEBP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Phosphatidylethanolamine Binding Protein 1 (PEBP1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Phosphatidylethanolamine Binding Protein 1 (PEBP1) ELISA Kit

DLR-PEBP1-Hu-96T 96T
EUR 673
  • Should the Human Phosphatidylethanolamine Binding Protein 1 (PEBP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Phosphatidylethanolamine Binding Protein 1 (PEBP1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human RalA Binding Protein 1 (RALBP1) ELISA Kit

DLR-RALBP1-Hu-48T 48T
EUR 517
  • Should the Human RalA Binding Protein 1 (RALBP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human RalA Binding Protein 1 (RALBP1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human RalA Binding Protein 1 (RALBP1) ELISA Kit

DLR-RALBP1-Hu-96T 96T
EUR 673
  • Should the Human RalA Binding Protein 1 (RALBP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human RalA Binding Protein 1 (RALBP1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Selenium Binding Protein 1 (SELENBP1) ELISA Kit

DLR-SELENBP1-Hu-48T 48T
EUR 517
  • Should the Human Selenium Binding Protein 1 (SELENBP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Selenium Binding Protein 1 (SELENBP1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Selenium Binding Protein 1 (SELENBP1) ELISA Kit

DLR-SELENBP1-Hu-96T 96T
EUR 673
  • Should the Human Selenium Binding Protein 1 (SELENBP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Selenium Binding Protein 1 (SELENBP1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Formin Binding Protein 1 (FNBP1) ELISA Kit

DLR-FNBP1-Hu-48T 48T
EUR 517
  • Should the Human Formin Binding Protein 1 (FNBP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Formin Binding Protein 1 (FNBP1) in samples from tissue homogenates or other biological fluids.

Human Formin Binding Protein 1 (FNBP1) ELISA Kit

DLR-FNBP1-Hu-96T 96T
EUR 673
  • Should the Human Formin Binding Protein 1 (FNBP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Formin Binding Protein 1 (FNBP1) in samples from tissue homogenates or other biological fluids.

Human Hyaluronan Binding Protein 1 (HABP1) ELISA Kit

DLR-HABP1-Hu-48T 48T
EUR 479
  • Should the Human Hyaluronan Binding Protein 1 (HABP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Hyaluronan Binding Protein 1 (HABP1) in samples from serum, plasma or other biological fluids.

Human Hyaluronan Binding Protein 1 (HABP1) ELISA Kit

DLR-HABP1-Hu-96T 96T
EUR 621
  • Should the Human Hyaluronan Binding Protein 1 (HABP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Hyaluronan Binding Protein 1 (HABP1) in samples from serum, plasma or other biological fluids.

Human Phosphatidylethanolamine-binding protein 1(PEBP1) ELISA kit

CSB-EL017766HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Phosphatidylethanolamine-binding protein 1 (PEBP1) in samples from serum, plasma, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Phosphatidylethanolamine-binding protein 1(PEBP1) ELISA kit

1-CSB-EL017766HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Phosphatidylethanolamine-binding protein 1(PEBP1) in samples from serum, plasma, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human X Box Binding Protein 1 ELISA kit

E01X0002-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human X Box Binding Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human X Box Binding Protein 1 ELISA kit

E01X0002-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human X Box Binding Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human X Box Binding Protein 1 ELISA kit

E01X0002-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human X Box Binding Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Syntaxin binding protein 1(STXBP1) ELISA kit

E01S0420-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Syntaxin binding protein 1(STXBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Syntaxin binding protein 1(STXBP1) ELISA kit

E01S0420-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Syntaxin binding protein 1(STXBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Syntaxin binding protein 1(STXBP1) ELISA kit

E01S0420-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Syntaxin binding protein 1(STXBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Calcium binding protein 1(CABP1) ELISA kit

E01C1297-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Calcium binding protein 1(CABP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Calcium binding protein 1(CABP1) ELISA kit

E01C1297-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Calcium binding protein 1(CABP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Calcium binding protein 1(CABP1) ELISA kit

E01C1297-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Calcium binding protein 1(CABP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Actin binding LIM protein 1 ELISA kit

E01A0983-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Actin binding LIM protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Actin binding LIM protein 1 ELISA kit

E01A0983-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Actin binding LIM protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Actin binding LIM protein 1 ELISA kit

E01A0983-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Actin binding LIM protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Heme binding protein 1(HEBP1) ELISA kit

E01H1367-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Heme binding protein 1(HEBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Heme binding protein 1(HEBP1) ELISA kit

E01H1367-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Heme binding protein 1(HEBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Heme binding protein 1(HEBP1) ELISA kit

E01H1367-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Heme binding protein 1(HEBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human AE Binding Protein 1 (AEBP1) ELISA Kit

20-abx150582
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Immunoglobulin Binding Protein 1 (IGBP1) ELISA Kit

20-abx156788
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human RLBP1(Retinaldehyde Binding Protein 1) ELISA Kit