Human RAB7A(RAB7A, Member RAS Oncogene Family) ELISA Kit

To Order: Contact

Human RAB7A, Member RAS Oncogene Family (RAB7A) ELISA Kit

RDR-RAB7A-Hu-96Tests 96 Tests
EUR 756

Human RAB7A, Member RAS Oncogene Family (RAB7A) ELISA Kit

RD-RAB7A-Hu-48Tests 48 Tests
EUR 521

Human RAB7A, Member RAS Oncogene Family (RAB7A) ELISA Kit

RD-RAB7A-Hu-96Tests 96 Tests
EUR 723

RAB7A, Member RAS Oncogene Family (RAB7A) Antibody

abx117042-100ug 100 ug
EUR 467
  • Shipped within 5-10 working days.

RAB7A, Member RAS Oncogene Family (RAB7A) Antibody

20-abx127026
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

RAB7A, Member RAS Oncogene Family (RAB7A) Antibody

abx122528-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

RAB7A, Member RAS Oncogene Family (RAB7A) Antibody

abx237043-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

RAB7A, Member RAS Oncogene Family (RAB7A) Antibody

20-abx302116
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RAB7A, Member RAS Oncogene Family (RAB7A) Antibody

20-abx000788
  • EUR 495.00
  • EUR 356.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAB7A, Member RAS Oncogene Family (RAB7A) Antibody

20-abx001068
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Human RAB7A, Member RAS Oncogene Family (RAB7A) ELISA Kit

20-abx156866
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human RAB7A, Member RAS Oncogene Family ELISA Kit (RAB7A)

RK02178 96 Tests
EUR 521

Human RAB7A, Member RAS Oncogene Family (RAB7A) ELISA Kit

SEK300Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB7A, Member RAS Oncogene Family (RAB7A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB7A, Member RAS Oncogene Family (RAB7A) in tissue homogenates, cell lysates and other biological fluids.

Human RAB7A, Member RAS Oncogene Family (RAB7A) ELISA Kit

SEK300Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB7A, Member RAS Oncogene Family (RAB7A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB7A, Member RAS Oncogene Family (RAB7A) in tissue homogenates, cell lysates and other biological fluids.

Human RAB7A, Member RAS Oncogene Family (RAB7A) ELISA Kit

SEK300Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB7A, Member RAS Oncogene Family (RAB7A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB7A, Member RAS Oncogene Family (RAB7A) in tissue homogenates, cell lysates and other biological fluids.

Human RAB7A, Member RAS Oncogene Family (RAB7A) ELISA Kit

SEK300Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB7A, Member RAS Oncogene Family (RAB7A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB7A, Member RAS Oncogene Family (RAB7A) in tissue homogenates, cell lysates and other biological fluids.

Human RAB7A, Member RAS Oncogene Family (RAB7A) ELISA Kit

4-SEK300Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as RAB7A, Member RAS Oncogene Family elisa. Alternative names of the recognized antigen: RAB7
  • Ras-related protein Rab-7a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human RAB7A, Member RAS Oncogene Family (RAB7A) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human RAB7A, Member RAS Oncogene Family (RAB7A) CLIA Kit

20-abx495849
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

RAB7A, Member RAS Oncogene Family (RAB7A) Antibody (HRP)

20-abx314287
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RAB7A, Member RAS Oncogene Family (RAB7A) Antibody (FITC)

20-abx314288
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RAB7A, Member RAS Oncogene Family (RAB7A) Antibody (Biotin)

20-abx314289
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ELISA kit for Human RAB7A (RAB7A, Member RAS Oncogene Family)

ELK5152 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to RAB7A, Member RAS Oncogene Family (RAB7A). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody spec
  • Show more
Description: A sandwich ELISA kit for detection of RAB7A, Member RAS Oncogene Family from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

RAB7A, Member RAS Oncogene Family Protein

20-abx260842
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Recombinant Human RAB7A, Member RAS Oncogene Family

7-06004 5µg Ask for price

Recombinant Human RAB7A, Member RAS Oncogene Family

7-06005 20µg Ask for price

Recombinant Human RAB7A, Member RAS Oncogene Family

7-06006 1mg Ask for price

RAB7A, Member RAS Oncogene Family Human Recombinant Protein

PROTP51149 Regular: 20ug
EUR 317
Description: RAB7A produced in E.Coli is a single, non-glycosylated polypeptide chain containing 227 amino acids (1-207a.a.) and having a molecular mass of 25.6kDa.;RAB7A is fused to a 20 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Rab7a/ Rat Rab7a ELISA Kit

ELI-44430r 96 Tests
EUR 886

RAB7A ELISA KIT|Human

EF002258 96 Tests
EUR 689

RAB7A antibody

38205-100ul 100ul
EUR 252

RAB7A Antibody

DF6288 200ul
EUR 304
Description: RAB7A Antibody detects endogenous levels of total RAB7A.

RAB7A Antibody

CSB-PA019219KA01HU-
EUR 335
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against RAB7A. Recognizes RAB7A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

RAB7A Antibody

CSB-PA019219KA01HU-100ul 100ul
EUR 389
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against RAB7A. Recognizes RAB7A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

RAB7A Antibody

1-CSB-PA019219LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB7A. Recognizes RAB7A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

RAB7A siRNA

20-abx904434
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAB7A siRNA

20-abx930704
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAB7A siRNA

20-abx930705
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAB7A Antibody

ABD6288 100 ug
EUR 438

EGFP- Rab7A

PVT10344 2 ug
EUR 266

anti-RAB7A

YF-PA15488 100 ug
EUR 403
Description: Rabbit polyclonal to RAB7A

Canine RAB7A ELISA KIT

ELI-44429d 96 Tests
EUR 928

Human RAB7A/ Ras-related protein Rab-7a ELISA Kit

E2947Hu 1 Kit
EUR 605

Human Ras- related protein Rab- 7a, RAB7A ELISA KIT

ELI-36110h 96 Tests
EUR 824

RAB7A ELISA Kit (Human) (OKCD02032)

OKCD02032 96 Wells
EUR 831
Description: Description of target: Key regulator in endo-lysosomal trafficking. Governs early-to-late endosomal maturation, microtubule minus-end as well as plus-end directed endosomal migration and positioning, and endosome-lysosome transport through different protein-protein interaction cascades. Plays a central role, not only in endosomal traffic, but also in many other cellular and physiological events, such as growth-factor-mediated cell signaling, nutrient-transportor mediated nutrient uptake, neurotrophin transport in the axons of neurons and lipid metabolism. Also involved in regulation of some specialized endosomal membrane trafficking, such as maturation of melanosomes, pathogen-induced phagosomes (or vacuoles) and autophagosomes. Plays a role in the maturation and acidification of phagosomes that engulf pathogens, such as S.aureus and M.tuberculosis. Plays a role in the fusion of phagosomes with lysosomes. Plays important roles in microbial pathogen infection and survival, as well as in participating in the life cycle of viruses. Microbial pathogens possess survival strategies governed by RAB7A, sometimes by employing RAB7A function (e.g. Salmonella) and sometimes by excluding RAB7A function (e.g. Mycobacterium). In concert with RAC1, plays a role in regulating the formation of RBs (ruffled borders) in osteoclasts. Controls the endosomal trafficking and neurite outgrowth signaling of NTRK1/TRKA.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.113 ng/mL

RAB7A ELISA Kit (Human) (OKEH08041)

OKEH08041 96 Wells
EUR 896
Description: Description of target: RAB family members are small, RAS-related GTP-binding proteins that are important regulators of vesicular transport. Each RAB protein targets multiple proteins that act in exocytic / endocytic pathways. This gene encodes a RAB family member that regulates vesicle traffic in the late endosomes and also from late endosomes to lysosomes. This encoded protein is also involved in the cellular vacuolation of the VacA cytotoxin of Helicobacter pylori. Mutations at highly conserved amino acid residues in this gene have caused some forms of Charcot-Marie-Tooth (CMT) type 2 neuropathies.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.23ng/mL

Rabbit Ras- related protein Rab- 7a, RAB7A ELISA KIT

ELI-18192Ra 96 Tests
EUR 928

Bovine Ras- related protein Rab- 7a, RAB7A ELISA KIT

ELI-22150b 96 Tests
EUR 928

Mouse Ras- related protein Rab- 7a, Rab7a ELISA KIT

ELI-30429m 96 Tests
EUR 865

RAB7A Rabbit pAb

A1154-100ul 100 ul
EUR 308

RAB7A Rabbit pAb

A1154-200ul 200 ul
EUR 459

RAB7A Rabbit pAb

A1154-20ul 20 ul
EUR 183

RAB7A Rabbit pAb

A1154-50ul 50 ul
EUR 223

RAB7A Rabbit pAb

A12344-100ul 100 ul
EUR 308

RAB7A Rabbit pAb

A12344-200ul 200 ul
EUR 459

RAB7A Rabbit pAb

A12344-20ul 20 ul Ask for price

RAB7A Rabbit pAb

A12344-50ul 50 ul Ask for price

RAB7A Rabbit pAb

A12784-100ul 100 ul
EUR 308

RAB7A Rabbit pAb

A12784-200ul 200 ul
EUR 459

RAB7A Rabbit pAb

A12784-20ul 20 ul
EUR 183

RAB7A Rabbit pAb

A12784-50ul 50 ul
EUR 223

RAB7A Blocking Peptide

DF6288-BP 1mg
EUR 195

RAB7A Conjugated Antibody

C38205 100ul
EUR 397

RAB7A cloning plasmid

CSB-CL019219HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 696
  • Sequence: atgagtttctcatccaggccagtccccgagatcctgaaaacttcccatttgttgtgttgggaaacaagattgacctcgaaaacagacaagtggccacaaagcgggcacaggcctggtgctacagcaaaaacaacattccctactttgagaccagtgccaaggaggccatcaacgtg
  • Show more
Description: A cloning plasmid for the RAB7A gene.

anti- RAB7A antibody

FNab07043 100µg
EUR 505.25
  • Immunogen: RAB7A, member RAS oncogene family
  • Uniprot ID: P51149
  • Gene ID: 7879
  • Research Area: Signal Transduction
Description: Antibody raised against RAB7A

Anti-RAB7A antibody

PAab07043 100 ug
EUR 355

pENTR223- RAB7A- T8G

PVT11507 2 ug
EUR 273

pCMV-SPORT6-RAB7A

PVT13684 2 ug
EUR 391

EGFP-Rab7A Q67L

PVT17461 2 ug
EUR 300

Anti-RAB7A antibody

STJ25267 100 µl
EUR 277
Description: RAB family members are small, RAS-related GTP-binding proteins that are important regulators of vesicular transport. Each RAB protein targets multiple proteins that act in exocytic / endocytic pathways. This gene encodes a RAB family member that regulates vesicle traffic in the late endosomes and also from late endosomes to lysosomes. This encoded protein is also involved in the cellular vacuolation of the VacA cytotoxin of Helicobacter pylori. Mutations at highly conserved amino acid residues in this gene have caused some forms of Charcot-Marie-Tooth (CMT) type 2 neuropathies.

Anti-RAB7A antibody

STJ114224 100 µl
EUR 277
Description: RAB family members are small, RAS-related GTP-binding proteins that are important regulators of vesicular transport. Each RAB protein targets multiple proteins that act in exocytic / endocytic pathways. This gene encodes a RAB family member that regulates vesicle traffic in the late endosomes and also from late endosomes to lysosomes. This encoded protein is also involved in the cellular vacuolation of the VacA cytotoxin of Helicobacter pylori. Mutations at highly conserved amino acid residues in this gene have caused some forms of Charcot-Marie-Tooth (CMT) type 2 neuropathies.

Anti-RAB7A antibody

STJ114654 100 µl
EUR 277
Description: RAB family members are small, RAS-related GTP-binding proteins that are important regulators of vesicular transport. Each RAB protein targets multiple proteins that act in exocytic / endocytic pathways. This gene encodes a RAB family member that regulates vesicle traffic in the late endosomes and also from late endosomes to lysosomes. This encoded protein is also involved in the cellular vacuolation of the VacA cytotoxin of Helicobacter pylori. Mutations at highly conserved amino acid residues in this gene have caused some forms of Charcot-Marie-Tooth (CMT) type 2 neuropathies.

Anti-Rab7a antibody

STJ140063 150 µg
EUR 231
Description: Goat polyclonal antibody to mouse Rab7. Rab7 belongs to the small GTPase superfamily, Rab family. It has been localized to late endosomes, regulates vesicle traffic in the late endosomes and also from late endosomes to lysosomes. Rab7 also contributes to the maturation of phagosomes (acidification).

Human RAB7A shRNA Plasmid

20-abx955306
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RAB7A Recombinant Protein (Human)

RP025543 100 ug Ask for price

Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit

DLR-RAB1A-Hu-48T 48T
EUR 517
  • Should the Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human RAB1A, Member RAS Oncogene Family (RAB1A) in samples from tissue homogenates or other biological fluids.

Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit

DLR-RAB1A-Hu-96T 96T
EUR 673
  • Should the Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human RAB1A, Member RAS Oncogene Family (RAB1A) in samples from tissue homogenates or other biological fluids.

Human RAB37, Member RAS Oncogene Family (RAB37) ELISA Kit

DLR-RAB37-Hu-48T 48T
EUR 554
  • Should the Human RAB37, Member RAS Oncogene Family (RAB37) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human RAB37, Member RAS Oncogene Family (RAB37) in samples from tissue homogenates or other biological fluids.

Human RAB37, Member RAS Oncogene Family (RAB37) ELISA Kit

DLR-RAB37-Hu-96T 96T
EUR 725
  • Should the Human RAB37, Member RAS Oncogene Family (RAB37) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human RAB37, Member RAS Oncogene Family (RAB37) in samples from tissue homogenates or other biological fluids.

Human RAB5A, Member RAS Oncogene Family (RAB5A) ELISA Kit

DLR-RAB5A-Hu-48T 48T
EUR 517
  • Should the Human RAB5A, Member RAS Oncogene Family (RAB5A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human RAB5A, Member RAS Oncogene Family (RAB5A) in samples from tissue homogenates or other biological fluids.

Human RAB5A, Member RAS Oncogene Family (RAB5A) ELISA Kit

DLR-RAB5A-Hu-96T 96T
EUR 673
  • Should the Human RAB5A, Member RAS Oncogene Family (RAB5A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human RAB5A, Member RAS Oncogene Family (RAB5A) in samples from tissue homogenates or other biological fluids.

Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit

DLR-RAB5C-Hu-48T 48T
EUR 554
  • Should the Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human RAB5C, Member RAS Oncogene Family (RAB5C) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit

DLR-RAB5C-Hu-96T 96T
EUR 725
  • Should the Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human RAB5C, Member RAS Oncogene Family (RAB5C) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human RAB8B, Member RAS Oncogene Family (RAB8B) ELISA Kit

DLR-RAB8B-Hu-48T 48T
EUR 517
  • Should the Human RAB8B, Member RAS Oncogene Family (RAB8B) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human RAB8B, Member RAS Oncogene Family (RAB8B) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human RAB8B, Member RAS Oncogene Family (RAB8B) ELISA Kit

DLR-RAB8B-Hu-96T 96T
EUR 673
  • Should the Human RAB8B, Member RAS Oncogene Family (RAB8B) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human RAB8B, Member RAS Oncogene Family (RAB8B) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit

20-abx152910
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human RAB37, Member RAS Oncogene Family (RAB37) ELISA Kit

20-abx152911
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human RAB5A, Member RAS Oncogene Family (RAB5A) ELISA Kit

20-abx152912
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit

20-abx258183
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human RAB27B, Member RAS Oncogene Family (RAB27B) ELISA Kit

20-abx382610
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Human RAB8B, Member RAS Oncogene Family (RAB8B) ELISA Kit

20-abx382639
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Human RAB8B, Member RAS Oncogene Family (RAB8B) ELISA Kit

20-abx585081
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Human RAB5A, Member RAS Oncogene Family(RAB5A)ELISA Kit

QY-E04663 96T
EUR 361

Human RAB37, Member RAS Oncogene Family(RAB37) ELISA Kit

QY-E04664 96T
EUR 361

Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit

RDR-RAB1A-Hu-48Tests 48 Tests
EUR 544

Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit

RDR-RAB1A-Hu-96Tests 96 Tests
EUR 756

Human RAB37, Member RAS Oncogene Family (RAB37) ELISA Kit

RDR-RAB37-Hu-48Tests 48 Tests
EUR 589

Human RAB37, Member RAS Oncogene Family (RAB37) ELISA Kit

RDR-RAB37-Hu-96Tests 96 Tests
EUR 820

Human RAB5A, Member RAS Oncogene Family (RAB5A) ELISA Kit

RDR-RAB5A-Hu-48Tests 48 Tests
EUR 544

Human RAB5A, Member RAS Oncogene Family (RAB5A) ELISA Kit

RDR-RAB5A-Hu-96Tests 96 Tests
EUR 756

Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit

RDR-RAB5C-Hu-48Tests 48 Tests
EUR 589

Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit

RDR-RAB5C-Hu-96Tests 96 Tests
EUR 820

Human RAB8B, Member RAS Oncogene Family (RAB8B) ELISA Kit

RDR-RAB8B-Hu-48Tests 48 Tests
EUR 544

Human RAB8B, Member RAS Oncogene Family (RAB8B) ELISA Kit

RDR-RAB8B-Hu-96Tests 96 Tests
EUR 756

Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit

RD-RAB1A-Hu-48Tests 48 Tests
EUR 521

Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit

RD-RAB1A-Hu-96Tests 96 Tests
EUR 723

Human RAB37, Member RAS Oncogene Family (RAB37) ELISA Kit

RD-RAB37-Hu-48Tests 48 Tests
EUR 563

Human RAB37, Member RAS Oncogene Family (RAB37) ELISA Kit

RD-RAB37-Hu-96Tests 96 Tests
EUR 783

Human RAB5A, Member RAS Oncogene Family (RAB5A) ELISA Kit

RD-RAB5A-Hu-48Tests 48 Tests
EUR 521

Human RAB5A, Member RAS Oncogene Family (RAB5A) ELISA Kit

RD-RAB5A-Hu-96Tests 96 Tests
EUR 723

Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit

RD-RAB5C-Hu-48Tests 48 Tests
EUR 563

Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit

RD-RAB5C-Hu-96Tests 96 Tests
EUR 783

Human RAB8B, Member RAS Oncogene Family (RAB8B) ELISA Kit

RD-RAB8B-Hu-48Tests 48 Tests
EUR 521

Human RAB8B, Member RAS Oncogene Family (RAB8B) ELISA Kit

RD-RAB8B-Hu-96Tests 96 Tests
EUR 723

Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit

SEP757Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB5C, Member RAS Oncogene Family (RAB5C) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB5C, Member RAS Oncogene Family (RAB5C) in serum, plasma, tissue homogenates and other biological fluids.

Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit

SEP757Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB5C, Member RAS Oncogene Family (RAB5C) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB5C, Member RAS Oncogene Family (RAB5C) in serum, plasma, tissue homogenates and other biological fluids.

Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit

SEP757Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB5C, Member RAS Oncogene Family (RAB5C) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB5C, Member RAS Oncogene Family (RAB5C) in serum, plasma, tissue homogenates and other biological fluids.

Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit

SEP757Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB5C, Member RAS Oncogene Family (RAB5C) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB5C, Member RAS Oncogene Family (RAB5C) in serum, plasma, tissue homogenates and other biological fluids.

Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit

4-SEP757Hu
  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as RAB5C, Member RAS Oncogene Family elisa. Alternative names of the recognized antigen: RABL
  • RAB5CL
  • Ras-related protein Rab-5C
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human RAB5C, Member RAS Oncogene Family (RAB5C) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit

SEJ783Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB1A, Member RAS Oncogene Family (RAB1A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB1A, Member RAS Oncogene Family (RAB1A) in Tissue homogenates and other biological fluids.

Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit

SEJ783Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB1A, Member RAS Oncogene Family (RAB1A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB1A, Member RAS Oncogene Family (RAB1A) in Tissue homogenates and other biological fluids.

Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit

SEJ783Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB1A, Member RAS Oncogene Family (RAB1A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB1A, Member RAS Oncogene Family (RAB1A) in Tissue homogenates and other biological fluids.

Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit

SEJ783Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB1A, Member RAS Oncogene Family (RAB1A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB1A, Member RAS Oncogene Family (RAB1A) in Tissue homogenates and other biological fluids.

Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit

4-SEJ783Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as RAB1A, Member RAS Oncogene Family elisa. Alternative names of the recognized antigen: RAB1
  • YPT1
  • Ras-related protein Rab-1A
  • YPT1-related protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human RAB1A, Member RAS Oncogene Family (RAB1A) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human RAB5A, Member RAS Oncogene Family (RAB5A) ELISA Kit

SEK305Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB5A, Member RAS Oncogene Family (RAB5A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB5A, Member RAS Oncogene Family (RAB5A) in Tissue homogenates and other biological fluids.

Human RAB5A, Member RAS Oncogene Family (RAB5A) ELISA Kit

SEK305Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB5A, Member RAS Oncogene Family (RAB5A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB5A, Member RAS Oncogene Family (RAB5A) in Tissue homogenates and other biological fluids.

Human RAB5A, Member RAS Oncogene Family (RAB5A) ELISA Kit

SEK305Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB5A, Member RAS Oncogene Family (RAB5A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB5A, Member RAS Oncogene Family (RAB5A) in Tissue homogenates and other biological fluids.

Human RAB5A, Member RAS Oncogene Family (RAB5A) ELISA Kit

SEK305Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB5A, Member RAS Oncogene Family (RAB5A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB5A, Member RAS Oncogene Family (RAB5A) in Tissue homogenates and other biological fluids.

Human RAB5A, Member RAS Oncogene Family (RAB5A) ELISA Kit

4-SEK305Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as RAB5A, Member RAS Oncogene Family elisa. Alternative names of the recognized antigen: RAB5
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human RAB5A, Member RAS Oncogene Family (RAB5A) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human RAB37, Member RAS Oncogene Family (RAB37) ELISA Kit

SEM679Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB37, Member RAS Oncogene Family (RAB37) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB37, Member RAS Oncogene Family (RAB37) in Tissue homogenates and other biological fluids.

Human RAB37, Member RAS Oncogene Family (RAB37) ELISA Kit

SEM679Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB37, Member RAS Oncogene Family (RAB37) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB37, Member RAS Oncogene Family (RAB37) in Tissue homogenates and other biological fluids.

Human RAB37, Member RAS Oncogene Family (RAB37) ELISA Kit

SEM679Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB37, Member RAS Oncogene Family (RAB37) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB37, Member RAS Oncogene Family (RAB37) in Tissue homogenates and other biological fluids.

Human RAB37, Member RAS Oncogene Family (RAB37) ELISA Kit

SEM679Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB37, Member RAS Oncogene Family (RAB37) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB37, Member RAS Oncogene Family (RAB37) in Tissue homogenates and other biological fluids.

Human RAB37, Member RAS Oncogene Family (RAB37) ELISA Kit

4-SEM679Hu
  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as RAB37, Member RAS Oncogene Family elisa. Alternative names of the recognized antigen: Ras-related protein Rab-37
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human RAB37, Member RAS Oncogene Family (RAB37) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Rab10, Member Ras Oncogene Family Antibody

20-abx114958
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Rab11A, Member Ras Oncogene Family Antibody

20-abx114961
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Rab12, Member Ras Oncogene Family Antibody

20-abx114963
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Rab14, Member Ras Oncogene Family Antibody

20-abx114964
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Rab1A, Member Ras Oncogene Family Antibody

20-abx114967
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Rab32, Member Ras Oncogene Family Antibody

20-abx114980
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Rab39, Member Ras Oncogene Family Antibody

20-abx114985
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Rab3B, Member Ras Oncogene Family Antibody

20-abx114990
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Rab43, Member Ras Oncogene Family Antibody

20-abx114995
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Rab4A, Member Ras Oncogene Family Antibody

20-abx114996
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Rab5B, Member Ras Oncogene Family Antibody

20-abx114998
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Rab7B, Member Ras Oncogene Family Antibody

20-abx115001
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Rab8A, Member Ras Oncogene Family Antibody

20-abx115002
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Rab9B, Member Ras Oncogene Family Antibody

20-abx115006
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAP2B, Member RAS Oncogene Family Antibody

20-abx137206
  • EUR 704.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

RAB27A, Member RAS Oncogene Family Protein

20-abx260595
  • EUR 2861.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 25 ug
  • 5 ug
  • Shipped within 5-10 working days.

RAB11A, Member RAS Oncogene Family Protein

20-abx260596
  • EUR 2861.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 25 ug
  • 5 ug
  • Shipped within 5-10 working days.

RAB5B, Member RAS Oncogene Family Protein

20-abx260830
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

RAB27B, Member RAS Oncogene Family Protein

20-abx260840
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

RAB2B, Member RAS Oncogene Family Protein

20-abx260852
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

RAB6B, Member RAS Oncogene Family Protein

20-abx260859
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

RAB31, Member RAS Oncogene Family Protein

20-abx260886
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

RAP2B, Member RAS Oncogene Family Protein

20-abx261020
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

RAB5C, Member RAS Oncogene Family Protein

20-abx261048
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

RAB3D, Member RAS Oncogene Family Protein

20-abx261384
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

RAB17, Member RAS Oncogene Family Protein

20-abx261460
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

RAB3B, Member RAS Oncogene Family Protein

20-abx261461
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

RAB32, Member RAS Oncogene Family Protein

20-abx261507
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

RAB24, Member RAS Oncogene Family Protein

20-abx261508
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

RAB23, Member RAS Oncogene Family Protein

20-abx261518
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

RAB2A, Member RAS Oncogene Family Protein

20-abx261972
  • EUR 4490.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

RAB5A, Member RAS Oncogene Family Protein

20-abx261995
  • EUR 4490.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

RAB22, Member RAS Oncogene Family Protein

20-abx263453
  • EUR 230.00
  • EUR 1609.00
  • EUR 328.00
  • 1 µg
  • 50 ug
  • 5 ug
  • Shipped within 5-10 working days.

RAB1B, Member RAS Oncogene Family Protein

20-abx262456
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

RAB6A, Member RAS Oncogene Family Protein

20-abx262458
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

RAP2A, Member RAS Oncogene Family Protein

20-abx262464
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

RAP1B, Member RAS Oncogene Family Protein

20-abx262469
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

RAB1A, Member RAS Oncogene Family Protein

20-abx262476
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

RAB21, Member RAS Oncogene Family Protein

20-abx262484
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

RAB10, Member RAS Oncogene Family Protein

20-abx262581
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

RAP1A, Member RAS Oncogene Family Protein

20-abx262895
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

RAB3A, Member RAS Oncogene Family Protein

20-abx262903
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

RAB4A, Member RAS Oncogene Family Protein

20-abx262904
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

RAB14, Member RAS Oncogene Family Protein

20-abx262905
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

RAB13, Member RAS Oncogene Family Protein

20-abx262907
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

RAB35, Member RAS Oncogene Family Protein

20-abx262916
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

RAB18, Member RAS Oncogene Family Protein

20-abx262931
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

RAB34, Member RAS Oncogene Family Protein

20-abx262932
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

Recombinant Human RAB1A, Member RAS Oncogene Family

7-05971 2µg Ask for price

Recombinant Human RAB1A, Member RAS Oncogene Family

7-05972 10µg Ask for price

Recombinant Human RAB1A, Member RAS Oncogene Family

7-05973 1mg Ask for price

Recombinant Human RAB1B, Member RAS Oncogene Family

7-05974 2µg Ask for price

Recombinant Human RAB1B, Member RAS Oncogene Family

7-05975 10µg Ask for price

Recombinant Human RAB1B, Member RAS Oncogene Family

7-05976 1mg Ask for price

Recombinant Human RAB2A, Member RAS Oncogene Family

7-05977 5µg Ask for price

Recombinant Human RAB2A, Member RAS Oncogene Family

7-05978 20µg Ask for price

Recombinant Human RAB2A, Member RAS Oncogene Family

7-05979 1mg Ask for price

Recombinant Human RAB3A, Member RAS Oncogene Family

7-05980 5µg Ask for price

Recombinant Human RAB3A, Member RAS Oncogene Family

7-05981 20µg Ask for price

Recombinant Human RAB3A, Member RAS Oncogene Family

7-05982 1mg Ask for price

Recombinant Human RAB3B, Member RAS Oncogene Family

7-05983 5µg Ask for price

Recombinant Human RAB3B, Member RAS Oncogene Family

7-05984 20µg Ask for price

Recombinant Human RAB3B, Member RAS Oncogene Family

7-05985 1mg Ask for price

Recombinant Human RAB3D, Member RAS Oncogene Family

7-05986 5µg Ask for price

Recombinant Human RAB3D, Member RAS Oncogene Family

7-05987 20µg Ask for price

Recombinant Human RAB3D, Member RAS Oncogene Family

7-05988 1mg Ask for price

Recombinant Human RAB4A, Member RAS Oncogene Family

7-05989 2µg Ask for price

Recombinant Human RAB4A, Member RAS Oncogene Family

7-05990 10µg Ask for price

Recombinant Human RAB4A, Member RAS Oncogene Family

7-05991 1mg Ask for price

Recombinant Human RAB5A, Member RAS Oncogene Family

7-05992 5µg Ask for price

Recombinant Human RAB5A, Member RAS Oncogene Family

7-05993 20µg Ask for price

Recombinant Human RAB5A, Member RAS Oncogene Family

7-05994 1mg Ask for price

Recombinant Human RAB5B, Member RAS Oncogene Family

7-05995 5µg Ask for price

Recombinant Human RAB5B, Member RAS Oncogene Family

7-05996 20µg Ask for price

Recombinant Human RAB5B, Member RAS Oncogene Family

7-05997 1mg Ask for price

Recombinant Human RAB6A, Member RAS Oncogene Family

7-05998 2µg Ask for price

Recombinant Human RAB6A, Member RAS Oncogene Family

7-05999 10µg Ask for price

Recombinant Human RAB6A, Member RAS Oncogene Family

7-06000 1mg Ask for price

Recombinant Human RAB6B, Member RAS Oncogene Family

7-06001 5µg Ask for price

Recombinant Human RAB6B, Member RAS Oncogene Family

7-06002 20µg Ask for price

Recombinant Human RAB6B, Member RAS Oncogene Family

7-06003 1mg Ask for price

Recombinant Human RAB14, Member RAS Oncogene Family

7-06007 2µg Ask for price

Recombinant Human RAB14, Member RAS Oncogene Family

7-06008 10µg Ask for price

Recombinant Human RAB14, Member RAS Oncogene Family

7-06009 1mg Ask for price

Recombinant Human RAB11A, Member RAS Oncogene Family

7-06010 5µg Ask for price

Recombinant Human RAB11A, Member RAS Oncogene Family

7-06011 25µg Ask for price

Recombinant Human RAB11A, Member RAS Oncogene Family

7-06012 1mg Ask for price

Recombinant Human RAB13, Member RAS Oncogene Family

7-06013 2µg Ask for price

Recombinant Human RAB13, Member RAS Oncogene Family

7-06014 10µg Ask for price

Recombinant Human RAB13, Member RAS Oncogene Family

7-06015 1mg Ask for price

Recombinant Human RAB17, Member RAS Oncogene Family

7-06016 5µg Ask for price

Recombinant Human RAB17, Member RAS Oncogene Family

7-06017 20µg Ask for price

Recombinant Human RAB17, Member RAS Oncogene Family

7-06018 1mg Ask for price

Recombinant Human RAB21, Member RAS Oncogene Family

7-06019 2µg Ask for price

Recombinant Human RAB21, Member RAS Oncogene Family

7-06020 10µg Ask for price

Recombinant Human RAB21, Member RAS Oncogene Family

7-06021 1mg Ask for price

Recombinant Human RAB27A, Member RAS Oncogene Family

7-06022 5µg Ask for price

Recombinant Human RAB27A, Member RAS Oncogene Family

7-06023 25µg Ask for price

Recombinant Human RAB27A, Member RAS Oncogene Family

7-06024 1mg Ask for price

Recombinant Human RAB27B, Member RAS Oncogene Family

7-06025 5µg Ask for price

Human RAB7A(RAB7A, Member RAS Oncogene Family) ELISA Kit