Human LMF1(Lipase Maturation Factor 1) ELISA Kit

To Order: Contact

Human Lipase Maturation Factor 1 ELISA Kit (LMF1)
RK01786	Abclonal	96 Tests	EUR 521

Human Lipase Maturation Factor 1 (LMF1) ELISA Kit
SEE177Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lipase Maturation Factor 1 (LMF1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lipase Maturation Factor 1 (LMF1) in tissue homogenates, cell lysates and other biological fluids.

Human Lipase Maturation Factor 1 (LMF1) ELISA Kit
SEE177Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lipase Maturation Factor 1 (LMF1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lipase Maturation Factor 1 (LMF1) in tissue homogenates, cell lysates and other biological fluids.

Human Lipase Maturation Factor 1 (LMF1) ELISA Kit
SEE177Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lipase Maturation Factor 1 (LMF1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lipase Maturation Factor 1 (LMF1) in tissue homogenates, cell lysates and other biological fluids.

Human Lipase Maturation Factor 1 (LMF1) ELISA Kit
SEE177Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lipase Maturation Factor 1 (LMF1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lipase Maturation Factor 1 (LMF1) in tissue homogenates, cell lysates and other biological fluids.

Human Lipase Maturation Factor 1 (LMF1) ELISA Kit
4-SEE177Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Lipase Maturation Factor 1 elisa. Alternative names of the recognized antigen: TMEM112 JFP11 C16orf26 Transmembrane Protein 112
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Lipase Maturation Factor 1 (LMF1) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Lipase Maturation Factor 1 (LMF1) Antibody
20-abx177362	Abbexa	EUR 1205.00 EUR 578.00	1 mg 200 ug
Please enquire.

Lipase Maturation Factor 1 (LMF1) Antibody
20-abx173357	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Lipase Maturation Factor 1 (LMF1) Antibody
abx234805-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Human Lipase Maturation Factor 1 (LMF1) Protein
20-abx654192	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Mouse Lipase Maturation Factor 1 (LMF1) ELISA Kit
abx254864-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Mouse Lmf1/ Lipase maturation factor 1 ELISA Kit
E0876Mo	Sunlong	1 Kit	EUR 632

Bovine Lipase maturation factor 1, LMF1 ELISA KIT
ELI-27805b	Lifescience Market	96 Tests	EUR 928

Cow Lipase Maturation Factor 1 (LMF1) ELISA Kit
abx515087-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Lmf1(Lipase maturation factor 1) ELISA Kit
EM0512	FN Test	96T	EUR 567.6
Detection range: 0.78-50 ng/ml Uniprot ID: Q3U3R4 Alias: Lmf1/Tmem112/Transmembrane protein 112
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.469 ng/ml

Mouse Lipase maturation factor 1, Lmf1 ELISA KIT
ELI-47935m	Lifescience Market	96 Tests	EUR 865

Human Lipase Maturation Factor 1 (LMF1) CLIA Kit
20-abx494528	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human LMF1 (Lipase Maturation Factor 1)
ELK5124	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Lipase Maturation Factor 1 (LMF1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Show more
Description: A sandwich ELISA kit for detection of Lipase Maturation Factor 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Lipase maturation factor 1 (LMF1)
KTE61806-48T	Abbkine	48T	EUR 332
Lmf1 RNA was expressed at higher levels in tissues that express little or no lipase activity such as testis and pancreas, suggesting that Lmf1 may have additional functions in these tissues. The Lmf1 protein was predicted to contain 5 transmembrane d Show more
Description: Quantitative sandwich ELISA for measuring Human Lipase maturation factor 1 (LMF1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Lipase maturation factor 1 (LMF1)
KTE61806-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Lmf1 RNA was expressed at higher levels in tissues that express little or no lipase activity such as testis and pancreas, suggesting that Lmf1 may have additional functions in these tissues. The Lmf1 protein was predicted to contain 5 transmembrane d Show more
Description: Quantitative sandwich ELISA for measuring Human Lipase maturation factor 1 (LMF1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Lipase maturation factor 1 (LMF1)
KTE61806-96T	Abbkine	96T	EUR 539
Lmf1 RNA was expressed at higher levels in tissues that express little or no lipase activity such as testis and pancreas, suggesting that Lmf1 may have additional functions in these tissues. The Lmf1 protein was predicted to contain 5 transmembrane d Show more
Description: Quantitative sandwich ELISA for measuring Human Lipase maturation factor 1 (LMF1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Lipase maturation factor 1
EK2699	SAB	96 tests	EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Lipase maturation factor 1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human Lipase Maturation Factor 2 (LMF2) ELISA Kit
20-abx156845	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Lipase maturation factor 2, LMF2 ELISA KIT
ELI-20259h	Lifescience Market	96 Tests	EUR 824

Human Lipase Maturation Factor 2 (LMF2) ELISA Kit
SEE179Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lipase Maturation Factor 2 (LMF2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lipase Maturation Factor 2 (LMF2) in tissue homogenates, cell lysates and other biological fluids.

Human Lipase Maturation Factor 2 (LMF2) ELISA Kit
SEE179Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lipase Maturation Factor 2 (LMF2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lipase Maturation Factor 2 (LMF2) in tissue homogenates, cell lysates and other biological fluids.

Human Lipase Maturation Factor 2 (LMF2) ELISA Kit
SEE179Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lipase Maturation Factor 2 (LMF2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lipase Maturation Factor 2 (LMF2) in tissue homogenates, cell lysates and other biological fluids.

Human Lipase Maturation Factor 2 (LMF2) ELISA Kit
SEE179Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lipase Maturation Factor 2 (LMF2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lipase Maturation Factor 2 (LMF2) in tissue homogenates, cell lysates and other biological fluids.

Human Lipase Maturation Factor 2 (LMF2) ELISA Kit
4-SEE179Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Lipase Maturation Factor 2 elisa. Alternative names of the recognized antigen: TMEM153 TMEM112B Transmembrane Protein 153
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Lipase Maturation Factor 2 (LMF2) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Bovine Lipase maturation factor 2, LMF2 ELISA KIT
ELI-08613b	Lifescience Market	96 Tests	EUR 928

Chicken Lipase maturation factor 2, LMF2 ELISA KIT
ELI-38644c	Lifescience Market	96 Tests	EUR 928

Mouse Lipase maturation factor 2, Lmf2 ELISA KIT
ELI-39654m	Lifescience Market	96 Tests	EUR 865

ELISA kit for Human LMF2 (Lipase Maturation Factor 2)
ELK5126	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Lipase Maturation Factor 2 (LMF2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Show more
Description: A sandwich ELISA kit for detection of Lipase Maturation Factor 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Lipase Maturation Factor 2 (LMF2) CLIA Kit
20-abx494529	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Lipase Maturation Factor 2 (LMF2) Protein
20-abx654193	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Lipase Maturation Factor 2 (LMF2) Antibody
20-abx177363	Abbexa	EUR 1205.00 EUR 578.00	1 mg 200 ug
Please enquire.

Lipase Maturation Factor 2 (LMF2) Antibody
20-abx113521	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Lipase Maturation Factor 2 (LMF2) Antibody
20-abx173358	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Lipase Maturation Factor 2 (LMF2) Antibody
abx234806-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Lipase Maturation Factor 2 (LMF2) Antibody
20-abx318520	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Lipase Maturation Factor 2 (LMF2) Antibody (HRP)
20-abx304365	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Lipase Maturation Factor 2 (LMF2) Antibody (FITC)
20-abx304366	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Lipase Maturation Factor 2 (LMF2) Antibody (Biotin)
20-abx304367	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Human Maturation promoting factor ELISA kit
E01M0264-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Maturation promoting factor ELISA kit
E01M0264-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Maturation promoting factor ELISA kit
E01M0264-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human maturation promoting factor ELISA Kit
ELA-E1351h	Lifescience Market	96 Tests	EUR 824

Human Dual oxidase maturation factor 1, DUOXA1 ELISA KIT
ELI-31992h	Lifescience Market	96 Tests	EUR 824

Human maturation promoting factor,MPF ELISA Kit
201-12-0664	SunredBio	96 tests	EUR 440
This maturation promoting factor ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Glia Maturation Factor β ELISA kit
E01G0207-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Glia Maturation Factor β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Glia Maturation Factor β ELISA kit
E01G0207-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Glia Maturation Factor β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Glia Maturation Factor β ELISA kit
E01G0207-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Glia Maturation Factor β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human maturation promoting factor,MPF ELISA Kit
CN-03525H1	ChemNorm	96T	EUR 442

Human maturation promoting factor,MPF ELISA Kit
CN-03525H2	ChemNorm	48T	EUR 293

Human Maturation Promoting Factor (MPF) ELISA Kit
abx354414-96tests	Abbexa	96 tests	EUR 786
Shipped within 5-12 working days.

LMF1 ELISA Kit (Human) (OKCD02694)
OKCD02694	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: Involved in the maturation of specific proteins in the endoplasmic reticulum. Required for maturation and transport of active lipoprotein lipase (LPL) through the secretory pathway. Each LMF1 molecule chaperones 50 or more molecules of LPL.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.055 ng/mL

LMF1 ELISA Kit (Human) (OKEH07659)
OKEH07659	Aviva Systems Biology	96 Wells	EUR 896
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.39ng/mL

Rat Maturation promoting factor ELISA kit
E02M0264-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Maturation promoting factor ELISA kit
E02M0264-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Maturation promoting factor ELISA kit
E02M0264-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Maturation promoting factor ELISA kit
E04M0264-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Maturation promoting factor ELISA kit
E04M0264-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Maturation promoting factor ELISA kit
E04M0264-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Maturation promoting factor ELISA kit
E03M0264-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Maturation promoting factor ELISA kit
E03M0264-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Maturation promoting factor ELISA kit
E03M0264-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Maturation promoting factor ELISA kit
E06M0264-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Maturation promoting factor ELISA kit
E06M0264-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Maturation promoting factor ELISA kit
E06M0264-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Maturation promoting factor ELISA kit
E08M0264-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Maturation promoting factor ELISA kit
E08M0264-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Maturation promoting factor ELISA kit
E08M0264-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Maturation promoting factor ELISA kit
E07M0264-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Maturation promoting factor ELISA kit
E07M0264-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Maturation promoting factor ELISA kit
E07M0264-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Maturation promoting factor ELISA kit
E09M0264-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Maturation promoting factor ELISA kit
E09M0264-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Maturation promoting factor ELISA kit
E09M0264-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

GMFB Glia Maturation Factor Beta Human His Tag Recombinant Protein
PROTP60983-1	BosterBio	Regular: 20ug	EUR 317
Description: GMFB Human Recombinant produced in E.Coli is a signle, non-glycosylated, polypeptide chain containing 162 amino acids (1-142 a.a.)and having a total molecular mass of 18.8 kDa. ;GMGB is fused to a 20 amino acid His Tag at N-terminus and is purified by proprietary chromatographic techniques.

Human maturation promoting factor,MF/MPF ELISA Kit
201-12-1473	SunredBio	96 tests	EUR 440
This maturation promoting factor ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Glia Maturation Factor Beta (GMFb) ELISA Kit
abx252553-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-12 working days.

Human GMFβ(Glia Maturation Factor, Beta) ELISA Kit
EH3154	FN Test	96T	EUR 524.1
Detection range: 31.25-2000 pg/ml Uniprot ID: P60983 Alias: GMFβ/GMFB/glia maturation factor beta/glia maturation factor, beta/GMF/GMF-beta
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml

Human rRNA maturation factor homolog, YBEY ELISA KIT
ELI-17969h	Lifescience Market	96 Tests	EUR 824

Human maturation promoting factor,MF/MPF ELISA Kit
CN-04576H1	ChemNorm	96T	EUR 449

Human maturation promoting factor,MF/MPF ELISA Kit
CN-04576H2	ChemNorm	48T	EUR 299

Human Glia Maturation Factor Gamma (GMFG) ELISA Kit
abx387591-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human maturation promoting factor(MF/MPF)ELISA Kit
GA-E1489HM-48T	GenAsia Biotech	48T	EUR 289

Human maturation promoting factor(MF/MPF)ELISA Kit
GA-E1489HM-96T	GenAsia Biotech	96T	EUR 466

Human Glia maturation factor beta, GMFB ELISA KIT
ELI-38024h	Lifescience Market	96 Tests	EUR 824

Human Glia maturation factor gamma, GMFG ELISA KIT
ELI-48770h	Lifescience Market	96 Tests	EUR 824

Human Glia Maturation Factor Gamma(GMFg)ELISA Kit
QY-E02841	Qayee Biotechnology	96T	EUR 361

Human maturation promoting factor(MF/MPF)ELISA Kit
QY-E03953	Qayee Biotechnology	96T	EUR 361

Mouse Dual oxidase maturation factor 1, Duoxa1 ELISA KIT
ELI-09393m	Lifescience Market	96 Tests	EUR 865

Rat Glia Maturation Factor β ELISA kit
E02G0207-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Glia Maturation Factor β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Glia Maturation Factor β ELISA kit
E02G0207-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Glia Maturation Factor β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Glia Maturation Factor β ELISA kit
E02G0207-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Glia Maturation Factor β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Glia Maturation Factor β ELISA kit
E03G0207-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Glia Maturation Factor β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Glia Maturation Factor β ELISA kit
E03G0207-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Glia Maturation Factor β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Glia Maturation Factor β ELISA kit
E03G0207-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Glia Maturation Factor β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Glia Maturation Factor β ELISA kit
E04G0207-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Glia Maturation Factor β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Glia Maturation Factor β ELISA kit
E04G0207-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Glia Maturation Factor β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Glia Maturation Factor β ELISA kit
E04G0207-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Glia Maturation Factor β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Maturation promoting factor ELISA kit
E05M0264-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Maturation promoting factor ELISA kit
E05M0264-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Maturation promoting factor ELISA kit
E05M0264-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Glia Maturation Factor β ELISA kit
E06G0207-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Glia Maturation Factor β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Glia Maturation Factor β ELISA kit
E06G0207-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Glia Maturation Factor β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Glia Maturation Factor β ELISA kit
E06G0207-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Glia Maturation Factor β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Glia Maturation Factor β ELISA kit
E09G0207-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Glia Maturation Factor β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Glia Maturation Factor β ELISA kit
E09G0207-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Glia Maturation Factor β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Glia Maturation Factor β ELISA kit
E09G0207-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Glia Maturation Factor β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Glia Maturation Factor β ELISA kit
E08G0207-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Glia Maturation Factor β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Glia Maturation Factor β ELISA kit
E08G0207-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Glia Maturation Factor β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Glia Maturation Factor β ELISA kit
E08G0207-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Glia Maturation Factor β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Glia Maturation Factor β ELISA kit
E07G0207-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Glia Maturation Factor β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Glia Maturation Factor β ELISA kit
E07G0207-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Glia Maturation Factor β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Glia Maturation Factor β ELISA kit
E07G0207-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Glia Maturation Factor β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Maturation Promoting Factor (MPF) ELISA Kit
abx359985-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Pig Maturation Promoting Factor (MPF) ELISA Kit
abx361829-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rabbit Maturation Promoting Factor (MPF) ELISA Kit
abx362651-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Chicken Maturation Promoting Factor (MPF) ELISA Kit
abx356575-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

LMF1 ELISA Kit (Mouse) (OKEH03602)
OKEH03602	Aviva Systems Biology	96 Wells	EUR 779
Description: Description of target: Involved in the maturation of specific proteins in the endoplasmic reticulum. Required for maturation and transport of active lipoprotein lipase (LPL) through the secretory pathway. Each LMF1 molecule chaperones 50 or more molecules of LPL.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.401 ng/mL

Recombinant human LMF1
P2488	FN Test	100ug	Ask for price
Uniprot ID: Q96S06 Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human LMF1

ELISA kit for Human GMFB (Glia Maturation Factor, Beta)
E-EL-H1887	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's GMFB ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human GMFB. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Human GMFB (Glia Maturation Factor, Beta) in samples from Serum, Plasma, Cell supernatant

Human Dual oxidase maturation factor 2, DUOXA2 ELISA KIT
ELI-09171h	Lifescience Market	96 Tests	EUR 824

LMF1 antibody
70R-7300	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal LMF1 antibody raised against the N terminal of LMF1

LMF1 siRNA
20-abx922674	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

LMF1 siRNA
20-abx922675	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Guinea pig Glia Maturation Factor β ELISA kit
E05G0207-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Glia Maturation Factor β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Glia Maturation Factor β ELISA kit
E05G0207-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Glia Maturation Factor β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Glia Maturation Factor β ELISA kit
E05G0207-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Glia Maturation Factor β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Glia Maturation Factor Beta (GMFB) ELISA Kit
abx255674-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Bovine Glia maturation factor beta, GMFB ELISA KIT
ELI-09735b	Lifescience Market	96 Tests	EUR 928

Mouse Glia maturation factor beta, Gmfb ELISA KIT
ELI-27926m	Lifescience Market	96 Tests	EUR 865

Bovine Glia maturation factor gamma, GMFG ELISA KIT
ELI-31236b	Lifescience Market	96 Tests	EUR 928

Monkey Glia Maturation Factor Beta (GMFB) ELISA Kit
abx360079-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Pig Glia Maturation Factor Beta (GMFB) ELISA Kit
abx361800-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rabbit Glia Maturation Factor Beta (GMFB) ELISA Kit
abx362674-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Mouse Glia Maturation Factor Beta (GMFb) ELISA Kit
abx352752-96tests	Abbexa	96 tests	EUR 786
Shipped within 5-12 working days.

Chicken Glia Maturation Factor Beta (GMFB) ELISA Kit
abx357015-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rat GMFB(Glia Maturation Factor, Beta) ELISA Kit
ER1001	FN Test	96T	EUR 524.1
Detection range: 15.625-1000 ng/ml Uniprot ID: Q63228 Alias: GMFB/GMFβ/GMFB/glia maturation factor beta/glia maturation factor, beta/GMF/GMF-beta
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 9.375 ng/ml

Mouse rRNA maturation factor homolog, Ybey ELISA KIT
ELI-40242m	Lifescience Market	96 Tests	EUR 865

Mouse Glia maturation factor gamma, Gmfg ELISA KIT
ELI-48015m	Lifescience Market	96 Tests	EUR 865

Recombinant Human Glia Maturation Factor Beta
7-00607	CHI Scientific	2µg	Ask for price

Recombinant Human Glia Maturation Factor Beta
7-00608	CHI Scientific	10µg	Ask for price

Recombinant Human Glia Maturation Factor Beta
7-00609	CHI Scientific	1mg	Ask for price

Recombinant Human Glia Maturation Factor Gamma
7-00619	CHI Scientific	5µg	Ask for price

Recombinant Human Glia Maturation Factor Gamma
7-00620	CHI Scientific	20µg	Ask for price

Recombinant Human Glia Maturation Factor Gamma
7-00621	CHI Scientific	1mg	Ask for price

Dual Oxidase Maturation Factor 1 (DUOXA1) Antibody
abx122690-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Dual Oxidase Maturation Factor 1 (DUOXA1) Antibody
20-abx301060	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Human Lipase ELISA Kit
CN-04596H1	ChemNorm	96T	EUR 442

Human Lipase ELISA Kit
CN-04596H2	ChemNorm	48T	EUR 293

Human Spermatid maturation protein 1, SPEM1 ELISA KIT
ELI-29632h	Lifescience Market	96 Tests	EUR 824

Human LMF1 shRNA Plasmid
20-abx962092	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

LMF1 Recombinant Protein (Human)
RP017887	ABM	100 ug	Ask for price

Human Factor V (Factor 5) AssayMax ELISA Kit
EF1005-1	AssayPro	96 Well Plate	EUR 417

Human Factor VII (Factor 7) AssayMax ELISA Kit
EF1007-1	AssayPro	96 Well Plate	EUR 477

Human Factor IX (Factor 9) AssayMax ELISA Kit
EF1009-1	AssayPro	96 Well Plate	EUR 417

Human Factor X (Factor 10) AssayMax ELISA Kit
EF1010-1	AssayPro	96 Well Plate	EUR 477

Human Factor XI (Factor 11) AssayMax ELISA Kit
EF1011-1	AssayPro	96 Well Plate	EUR 396

Human Factor XII (Factor 12) AssayMax ELISA Kit
EF1012-1	AssayPro	96 Well Plate	EUR 396

Human Factor XIII (Factor 13) AssayMax ELISA Kit
EF1013-1	AssayPro	96 Well Plate	EUR 396

Glia Maturation Factor beta Protein
20-abx260749	Abbexa	EUR 3418.00 EUR 328.00 EUR 230.00	1 mg 20 ug 5 ug
Shipped within 5-10 working days.

Glia Maturation Factor beta Protein
20-abx262215	Abbexa	EUR 328.00 EUR 5826.00 EUR 230.00	10 ug 1 mg 2 µg
Shipped within 5-10 working days.

Glia Maturation Factor beta Protein
20-abx262218	Abbexa	EUR 328.00 EUR 5826.00 EUR 230.00	10 ug 1 mg 2 µg
Shipped within 5-10 working days.

Glia Maturation Factor beta Protein
20-abx262262	Abbexa	EUR 328.00 EUR 5826.00 EUR 230.00	10 ug 1 mg 2 µg
Shipped within 5-10 working days.

Human Heat Shock Factor Protein 1 (HSF 1) AssayMax ELISA kit
EH5215-1	AssayPro	96 Well Plate	EUR 417

Human Insulin-like Growth Factor 1 (IGF-1) AssayMax ELISA Kit
EI1001-1	AssayPro	96 Well Plate	EUR 477

ELISA kit for Mouse GMFB (Glia MatuRation Factor, Beta)
E-EL-M0552	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's GMFB ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse GMFB. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse GMFB (Glia MatuRation Factor, Beta) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Rat GMFB (Glia Maturation Factor, Beta)
E-EL-R0419	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's GMFB ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat GMFB. Standards or samples are added to the micro ELISA plate wells and combined with the Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat GMFB (Glia Maturation Factor, Beta) in samples from Serum, Plasma, Cell supernatant

Mouse Dual oxidase maturation factor 2, Duoxa2 ELISA KIT
ELI-09172m	Lifescience Market	96 Tests	EUR 865

Guinea pig Glia Maturation Factor Beta (GMFB) ELISA Kit
abx357953-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human Glia Maturation Factor Beta (GMFb) Protein
20-abx166815	Abbexa	EUR 676.00 EUR 272.00 EUR 2068.00 EUR 801.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Glia Maturation Factor Gamma (GMFg) Protein
20-abx167184	Abbexa	EUR 718.00 EUR 286.00 EUR 2207.00 EUR 843.00 EUR 509.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Glia Maturation Factor Gamma (GMFg) Protein
20-abx066773	Abbexa	EUR 718.00 EUR 286.00 EUR 2207.00 EUR 843.00 EUR 509.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Glia Maturation Factor Gamma (GMFG) Protein
20-abx260738	Abbexa	EUR 3418.00 EUR 328.00 EUR 230.00	1 mg 20 ug 5 ug
Shipped within 5-10 working days.

GMF beta, Glia Maturation Factor beta, human
RC218-18	Bio Basic	2ug	EUR 104.38
Product category: Proteins/Recombinant Proteins/Cytokines

LMF1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1221202	ABM	1.0 ug DNA	EUR 154

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1	SBI	25 ul each	EUR 627
Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1	SBI	5 reactions	EUR 1152
Category: Stem Cell Products

LMF1 Blocking Peptide
33R-6372	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of LMF1 antibody, catalog no. 70R-7300

LMF1 cloning plasmid
CSB-CL013000HU-10ug	Cusabio	10ug	EUR 495
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1377 Sequence: atgcccaccatcctctggctgatggactggtcagacatgaactccaacctggacttgctggctcttctcggactgggcatctcgtctttcgtactgatcacgggctgcgccaacatgcttctcatggctgccctgtggggcctctacatgtccctggttaatgtgggccatgtct Show more
Description: A cloning plasmid for the LMF1 gene.

anti- LMF1 antibody
FNab04805	FN Test	100µg	EUR 505.25
Immunogen: lipase maturation factor 1 Uniprot ID: Q96S06 Gene ID: 64788 Research Area: Cardiovascular, Metabolism, Signal Transduction
Description: Antibody raised against LMF1

Anti-LMF1 antibody
PAab04805	Lifescience Market	100 ug	EUR 355

pCMV-SPORT6-LMF1
PVT13144	Lifescience Market	2 ug	EUR 391

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

MGLL Human, Monoglyceride Lipase Human Recombinant Protein, Active
PROTQ99685-1	BosterBio	Regular: 5ug	EUR 317
Description: MGLL Human Recombinant fused with a 20 amino acid His tag at N-terminus produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 333 amino acids (1-313 a.a.) and having a molecular mass of 36.4kDa. The MGLL is purified by proprietary chromatographic techniques.

LIPG Human, Lipase Endothelial Human Recombinant Protein, HEK
PROTQ9Y5X9-1	BosterBio	Regular: 10ug	EUR 317
Description: LIPG Human Recombinant produced in HEK cells is a single, glycosylated, polypeptide chain (Ser21-Pro500) containing a total of 490 amino acids, having a calculated molecular mass of 55.8kDa. LIPG is fused to a 2 aa N-terminal linker, a 2 aa C-terminal linker and a 6 aa His tag at C-Terminus.

LPL Human, Lipoprotein Lipase Human Recombinant Protein, HEK
PROTP06858-1	BosterBio	Regular: 10ug	EUR 317
Description: The Recombinant Human LPL produced in HEK293 cell line has a molecular mass of 51.8kDa containing 461 amino acid residues of the human LPL (Ala28-Gly475, variant Asn > Ser318) and fused to a 13 a.a. Flag-tag at N-terminus.

Human pancreatic lipase ELISA Kit
DEIA1968	Creative Diagnostics	96T	EUR 627
Description: This CD Human pancreatic lipase (PL) ELISA Kit is a 1.5 hour solid-phase ELISA designed for the quantitative determination of Human PL. This ELISA kit for research use only, not for therapeutic or diagnostic applications!

Human Lipase, LPS ELISA kit
E01L0312-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Lipase, LPS in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Lipase, LPS ELISA kit
E01L0312-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Lipase, LPS in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Lipase, LPS ELISA kit
E01L0312-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Lipase, LPS in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Endothelial lipase ELISA kit
E01E0137-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Endothelial lipase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Endothelial lipase ELISA kit
E01E0137-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Endothelial lipase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Endothelial lipase ELISA kit
E01E0137-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Endothelial lipase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Triglyceride Lipase ELISA kit
E01T0559-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Triglyceride Lipase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Triglyceride Lipase ELISA kit
E01T0559-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Triglyceride Lipase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Triglyceride Lipase ELISA kit
E01T0559-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Triglyceride Lipase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Hepatic lipase ELISA kit
E01H0253-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Hepatic lipase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Hepatic lipase ELISA kit
E01H0253-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Hepatic lipase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Hepatic lipase ELISA kit
E01H0253-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Hepatic lipase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Lipoprotein Lipase ELISA kit
E01L0001-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Lipoprotein Lipase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Lipoprotein Lipase ELISA kit
E01L0001-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Lipoprotein Lipase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human LMF1(Lipase Maturation Factor 1) ELISA Kit