Human KLK13(Kallikrein 13) ELISA Kit

To Order: Contact

Human Kallikrein 13 (KLK13) ELISA Kit

RDR-KLK13-Hu-48Tests 48 Tests
EUR 544

Human Kallikrein 13 (KLK13) ELISA Kit

RDR-KLK13-Hu-96Tests 96 Tests
EUR 756

Human Kallikrein 13 (KLK13) ELISA Kit

RD-KLK13-Hu-48Tests 48 Tests
EUR 521

Human Kallikrein 13 (KLK13) ELISA Kit

RD-KLK13-Hu-96Tests 96 Tests
EUR 723

Mouse Kallikrein 13 (KLK13) ELISA Kit

DLR-KLK13-Mu-48T 48T
EUR 527
  • Should the Mouse Kallikrein 13 (KLK13) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Kallikrein 13 (KLK13) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Mouse Kallikrein 13 (KLK13) ELISA Kit

DLR-KLK13-Mu-96T 96T
EUR 688
  • Should the Mouse Kallikrein 13 (KLK13) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Kallikrein 13 (KLK13) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Mouse Kallikrein 13 (KLK13) ELISA Kit

RDR-KLK13-Mu-48Tests 48 Tests
EUR 557

Mouse Kallikrein 13 (KLK13) ELISA Kit

RDR-KLK13-Mu-96Tests 96 Tests
EUR 774

Mouse Kallikrein 13 (KLK13) ELISA Kit

RD-KLK13-Mu-48Tests 48 Tests
EUR 533

Mouse Kallikrein 13 (KLK13) ELISA Kit

RD-KLK13-Mu-96Tests 96 Tests
EUR 740

Human Kallikrein 13 (KLK13) ELISA Kit

20-abx152086
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Kallikrein- 13, KLK13 ELISA KIT

ELI-43303h 96 Tests
EUR 824

Human Kallikrein 13(KLK13)ELISA Kit

QY-E02952 96T
EUR 361

Human Kallikrein 13 (KLK13) ELISA Kit

SED373Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 13 (KLK13) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kallikrein 13 (KLK13) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Kallikrein 13 (KLK13) ELISA Kit

SED373Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 13 (KLK13) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kallikrein 13 (KLK13) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Kallikrein 13 (KLK13) ELISA Kit

SED373Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 13 (KLK13) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kallikrein 13 (KLK13) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Kallikrein 13 (KLK13) ELISA Kit

SED373Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 13 (KLK13) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kallikrein 13 (KLK13) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Kallikrein 13 (KLK13) ELISA Kit

4-SED373Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Kallikrein 13 elisa. Alternative names of the recognized antigen: KLK-L4
  • KLKL4
  • Kallikrein-like protein 4
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Kallikrein 13 (KLK13) in samples from Serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Kallikrein 13 (KLK13) Antibody

20-abx177245
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Kallikrein 13 (KLK13) Antibody

20-abx177246
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Kallikrein 13 (KLK13) Antibody

20-abx210856
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Kallikrein 13 (KLK13) Antibody

20-abx129211
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Kallikrein 13 (KLK13) Antibody

20-abx129912
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Kallikrein 13 (KLK13) Antibody

20-abx173224
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Kallikrein 13 (KLK13) Antibody

20-abx339236
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Recombinant Kallikrein 13 (KLK13)

4-RPD373Hu01
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9UKR3
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 32.2kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Kallikrein 13 expressed in: E.coli

Recombinant Kallikrein 13 (KLK13)

4-RPD373Mu01
  • EUR 512.16
  • EUR 240.00
  • EUR 1645.60
  • EUR 615.20
  • EUR 1130.40
  • EUR 406.00
  • EUR 3964.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P36368
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.8kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Kallikrein 13 expressed in: E.coli

Mouse Kallikrein 13 (KLK13) ELISA Kit

20-abx154281
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Kallikrein 13 (KLK13) ELISA Kit

SED373Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 13 (KLK13) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 13 (KLK13) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Mouse Kallikrein 13 (KLK13) ELISA Kit

SED373Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 13 (KLK13) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 13 (KLK13) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Mouse Kallikrein 13 (KLK13) ELISA Kit

SED373Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 13 (KLK13) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 13 (KLK13) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Mouse Kallikrein 13 (KLK13) ELISA Kit

SED373Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 13 (KLK13) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 13 (KLK13) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Mouse Kallikrein 13 (KLK13) ELISA Kit

4-SED373Mu
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Kallikrein 13 elisa. Alternative names of the recognized antigen: KLK-L4
  • KLKL4
  • Kallikrein-like protein 4
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Kallikrein 13 (KLK13) in samples from Serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Kallikrein 13 (KLK13) Protein

20-abx167044
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Kallikrein 13 (KLK13) CLIA Kit

20-abx494238
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human KLK13 (Kallikrein 13)

ELK4917 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Kallikrein 13 (KLK13). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Kallikrein 1
  • Show more
Description: A sandwich ELISA kit for detection of Kallikrein 13 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Kallikrein-13 (KLK13)

KTE61899-48T 48T
EUR 332
  • Kallikrein-13 is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Expression of this gene is regulated by steroid hormones and may be useful as a marker for breast cancer. An additional transcript variant has bee
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Kallikrein-13 (KLK13) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Kallikrein-13 (KLK13)

KTE61899-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Kallikrein-13 is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Expression of this gene is regulated by steroid hormones and may be useful as a marker for breast cancer. An additional transcript variant has bee
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Kallikrein-13 (KLK13) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Kallikrein-13 (KLK13)

KTE61899-96T 96T
EUR 539
  • Kallikrein-13 is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Expression of this gene is regulated by steroid hormones and may be useful as a marker for breast cancer. An additional transcript variant has bee
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Kallikrein-13 (KLK13) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse KLK13 (Kallikrein 13)

ELK7224 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Kallikrein 13 (KLK13). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Kallikrein 1
  • Show more
Description: A sandwich ELISA kit for detection of Kallikrein 13 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Mouse Kallikrein 13 (KLK13) CLIA Kit

20-abx494239
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Kallikrein 13 (KLK13) Protein

20-abx168449
  • EUR 718.00
  • EUR 286.00
  • EUR 2221.00
  • EUR 857.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

OVA conjugated Kallikrein 13 (KLK13)

4-CPD373Hu21
  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9UKR3
  • Buffer composition: PBS, pH 7.4.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): Inquire
  • Isoelectric Point: Inquire
Description: Recombinant Human Kallikrein 13 expressed in: chemical synthesis

Kallikrein 13 (KLK13) polyclonal antibody

ABP-PAB-10239 100 ug Ask for price
    • Product line: Miscellaneous
    • Brand:

Kallikrein 13 (KLK13) Polyclonal Antibody (Human)

4-PAD373Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK13 (Glu22~Gln277)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Kallikrein 13 (KLK13)

KLK13 Kallikrein-13 Human Recombinant Protein

PROTQ9UKR3 Regular: 5ug
EUR 317
Description: KLK13 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 284 amino acids (17-277 a.a) and having a molecular mass of 31.3kDa.;KLK13 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Recombinant Human Kallikrein 13/KLK13 (C-6His)

C362-10ug 10ug
EUR 202
Description: Supplied as a 0.2 μm filtered solution of 20mM MES, 150mM NaCl, 10% Glycerol, pH 5.5.

Recombinant Human Kallikrein 13/KLK13 (C-6His)

C362-1mg 1mg
EUR 2283
Description: Supplied as a 0.2 μm filtered solution of 20mM MES, 150mM NaCl, 10% Glycerol, pH 5.5.

Recombinant Human Kallikrein 13/KLK13 (C-6His)

C362-500ug 500ug
EUR 1613
Description: Supplied as a 0.2 μm filtered solution of 20mM MES, 150mM NaCl, 10% Glycerol, pH 5.5.

Recombinant Human Kallikrein 13/KLK13 (C-6His)

C362-50ug 50ug
EUR 496
Description: Supplied as a 0.2 μm filtered solution of 20mM MES, 150mM NaCl, 10% Glycerol, pH 5.5.

Kallikrein 13 (KLK13) Polyclonal Antibody (Human), APC

4-PAD373Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK13 (Glu22~Gln277)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Kallikrein 13 (KLK13). This antibody is labeled with APC.

Kallikrein 13 (KLK13) Polyclonal Antibody (Human), Biotinylated

4-PAD373Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK13 (Glu22~Gln277)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Kallikrein 13 (KLK13). This antibody is labeled with Biotin.

Kallikrein 13 (KLK13) Polyclonal Antibody (Human), Cy3

4-PAD373Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK13 (Glu22~Gln277)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Kallikrein 13 (KLK13). This antibody is labeled with Cy3.

Kallikrein 13 (KLK13) Polyclonal Antibody (Human), FITC

4-PAD373Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK13 (Glu22~Gln277)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Kallikrein 13 (KLK13). This antibody is labeled with FITC.

Kallikrein 13 (KLK13) Polyclonal Antibody (Human), HRP

4-PAD373Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK13 (Glu22~Gln277)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Kallikrein 13 (KLK13). This antibody is labeled with HRP.

Kallikrein 13 (KLK13) Polyclonal Antibody (Human), PE

4-PAD373Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK13 (Glu22~Gln277)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Kallikrein 13 (KLK13). This antibody is labeled with PE.

KLK13 Human, Kallikrein-13 Human Recombinant Protein, sf9

PROTQ9UKR3-1 Regular: 5ug
EUR 317
Description: KLK13 produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 267 amino acids (17-277a.a.) and having a molecular mass of 29.7kDa. (Molecular size on SDS-PAGE will appear at approximately 28-40kDa). KLK13 is expressed with a 6 amino acid His tag at C-Terminus and purified by proprietary chromatographic techniques.

Polyclonal KLK13 / Kallikrein 13 Antibody (aa262-277)

APR02667G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human KLK13 / Kallikrein 13 (aa262-277). This antibody is tested and proven to work in the following applications:

Kallikrein 13 (KLK13) Polyclonal Antibody (Human), APC-Cy7

4-PAD373Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK13 (Glu22~Gln277)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Kallikrein 13 (KLK13). This antibody is labeled with APC-Cy7.

Kallikrein 13 (KLK13) Polyclonal Antibody (Human, Mouse, Rat)

4-PAD373Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK13 (Val25~Ala261)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Kallikrein 13 (KLK13)

Kallikrein 13 (KLK13) Polyclonal Antibody (Human, Mouse, Rat), APC

4-PAD373Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK13 (Val25~Ala261)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Kallikrein 13 (KLK13). This antibody is labeled with APC.

Kallikrein 13 (KLK13) Polyclonal Antibody (Human, Mouse, Rat), Biotinylated

4-PAD373Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK13 (Val25~Ala261)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Kallikrein 13 (KLK13). This antibody is labeled with Biotin.

Kallikrein 13 (KLK13) Polyclonal Antibody (Human, Mouse, Rat), Cy3

4-PAD373Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK13 (Val25~Ala261)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Kallikrein 13 (KLK13). This antibody is labeled with Cy3.

Kallikrein 13 (KLK13) Polyclonal Antibody (Human, Mouse, Rat), FITC

4-PAD373Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK13 (Val25~Ala261)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Kallikrein 13 (KLK13). This antibody is labeled with FITC.

Kallikrein 13 (KLK13) Polyclonal Antibody (Human, Mouse, Rat), HRP

4-PAD373Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK13 (Val25~Ala261)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Kallikrein 13 (KLK13). This antibody is labeled with HRP.

Kallikrein 13 (KLK13) Polyclonal Antibody (Human, Mouse, Rat), PE

4-PAD373Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK13 (Val25~Ala261)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Kallikrein 13 (KLK13). This antibody is labeled with PE.

Kallikrein 13 (KLK13) Polyclonal Antibody (Human, Mouse, Rat), APC-Cy7

4-PAD373Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK13 (Val25~Ala261)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Kallikrein 13 (KLK13). This antibody is labeled with APC-Cy7.

99445-13 DCT 13 X 100MM

99445-13 250/pk
EUR 76
Description: Disposable Culture Tubes; DCT's, CGW

anti-Kallikrein 13

YF-PA18203 50 ul
EUR 363
Description: Mouse polyclonal to Kallikrein 13

99999 CAP 13-415

99999-13 1000/pk
EUR 219
Description: Disposable Screw Cap Culture Tubes; DSCCT's, Caps

9998 SCREW CAP 415/13

9998-13 288/pk
EUR 198
Description: General Apparatus; Stoppers

Kallikrein 13 Protein (OVA)

20-abx165562
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Anti-Kallikrein 13 (1G9)

YF-MA18049 100 ug
EUR 363
Description: Mouse monoclonal to Kallikrein 13

Human CellExp? Kallikrein-13, human recombinant

7413-10
EUR 278

ELISA kit for Human KLK13

EK5504 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human KLK13 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human KLK13 PicoKine ELISA Kit

EK1168 96 wells
EUR 425
Description: For quantitative detection of human KLK13 in cell culture supernates, cell lysates, serum and plasma(heparin, EDTA).

KLK13 ELISA Kit (Human) (OKCD00765)

OKCD00765 96 Wells
EUR 831
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 12.6 pg/mL

KLK13 ELISA Kit (Human) (OKBB00909)

OKBB00909 96 Wells
EUR 505
Description: Description of target: Kallikrein-13 is a protein that in humans is encoded by the KLK13 gene. It belongs to the kallikrein subgroup of serine proteases, which have diverse physiologic functions in many tissues. By genomic sequence analysis, KLK13 gene is mapped in a 300-kb region on chromosome 19q13.3-q13.4. It has been shown that recombinant hK13 produced in yeast can cleave synthetic peptides after the arginine residue and some extracellular matrix components. However, its exact physiological substrates and functions remain obscure. Despite the lack of knowledge on the physiological function of hK13, several studies have demonstrated that hK13 is implicated with cancer of the breast and ovary and it can serve as a favorable prognostic biomarker for these malignancies.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

99447 DSSCT 13 X 100MM W/ MARING SPOT

99447-13 250/pk
EUR 332
Description: Disposable Screw Cap Culture Tubes; DSCCT's, Lab Stock

99449 DSSCT 13 X 100MM W/O MARKING SPOT

99449-13 250/pk
EUR 281
Description: Disposable Screw Cap Culture Tubes; DSCCT's, Lab Stock

CA199 (Cancer antigen) ELISA test

13 96T/Box Ask for price
  • Area of application: Hormone testing
Description: ELISA based test for quantitative detection of CA199 (Cancer antigen)

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

KLK13 Antibody

36578-100ul 100ul
EUR 252

KLK13 Antibody

1-CSB-PA374084
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against KLK13. Recognizes KLK13 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

KLK13 Antibody

1-CSB-PA185718
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against KLK13. Recognizes KLK13 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

KLK13 protein

80R-4293 20 ug
EUR 327
Description: Purified Recombinant KLK13 protein (His tagged)

KLK13 antibody

70R-3265 50 ug
EUR 467
Description: Rabbit polyclonal KLK13 antibody raised against the middle region of KLK13

KLK13 siRNA

20-abx921819
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Human Kallikrein 3 ELISA Kit

55R-1761 1 kit
EUR 651
Description: ELISA kit for detection of Kallikrein 3 in the research laboratory

Human KalliKrein 1 ELISA kit

E01K0026-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human KalliKrein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human KalliKrein 1 ELISA kit

E01K0026-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human KalliKrein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human KalliKrein 1 ELISA kit

E01K0026-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human KalliKrein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 10 ELISA kit

E01K0070-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Kallikrein 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 10 ELISA kit

E01K0070-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Kallikrein 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 10 ELISA kit

E01K0070-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Kallikrein 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 11 ELISA kit

E01K0072-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Kallikrein 11 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 11 ELISA kit

E01K0072-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Kallikrein 11 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 11 ELISA kit

E01K0072-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Kallikrein 11 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 6 ELISA kit

E01K0073-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Kallikrein 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 6 ELISA kit

E01K0073-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Kallikrein 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 6 ELISA kit

E01K0073-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Kallikrein 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 7 ELISA kit

E01K0074-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Kallikrein 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 7 ELISA kit

E01K0074-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Kallikrein 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 7 ELISA kit

E01K0074-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Kallikrein 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 8 ELISA kit

E01K0075-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Kallikrein 8 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 8 ELISA kit

E01K0075-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Kallikrein 8 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 8 ELISA kit

E01K0075-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Kallikrein 8 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 2 ELISA kit

E01K0077-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Kallikrein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 2 ELISA kit

E01K0077-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Kallikrein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 2 ELISA kit

E01K0077-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Kallikrein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 3 ELISA kit

E01K0078-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Kallikrein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 3 ELISA kit

E01K0078-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Kallikrein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 3 ELISA kit

E01K0078-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Kallikrein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 5 ELISA kit

E01K0079-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Kallikrein 5 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 5 ELISA kit

E01K0079-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Kallikrein 5 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 5 ELISA kit

E01K0079-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Kallikrein 5 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 2 ELISA Kit

ELA-E0278h 96 Tests
EUR 824

Human Kallikrein 9 ELISA Kit

ELA-E0408h 96 Tests
EUR 824

Human Kallikrein 11 ELISA Kit

ELA-E0669h 96 Tests
EUR 824

Human Kallikrein 8 ELISA Kit

ELA-E0690h 96 Tests
EUR 824

Human Kallikrein 6 ELISA Kit

ELA-E0691h 96 Tests
EUR 824

Human Kallikrein 10 ELISA Kit

ELA-E0697h 96 Tests
EUR 824

Human Kallikrein 1 ELISA Kit

ELA-E0967h 96 Tests
EUR 824

Human Kallikrein 7 ELISA Kit

ELA-E1910h 96 Tests
EUR 824

Human Kallikrein 3 ELISA Kit

ELA-E8720h 96 Tests
EUR 824

Human Kallikrein 6 ELISA Kit

ELA-E8916h 96 Tests
EUR 824

Kallikrein 11 ELISA KIT|Human

EF010428 96 Tests
EUR 689

Human Kallikrein-6 ELISA Kit

LF-EK50923 1×96T
EUR 648

Human Kallikrein 14 ELISA Kit

LF-EK50970 1×96T
EUR 648

Human KLK13 shRNA Plasmid

20-abx958699
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

KLK13 Recombinant Protein (Human)

RP017230 100 ug Ask for price

Human Interleukin 13,IL-13 ELISA KIT

201-12-0099 96 tests
EUR 440
  • This Interleukin 13 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human cytokeratin 13,CK-13 ELISA Kit

201-12-1608 96 tests
EUR 440
  • This cytokeratin 13 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Interleukin 13, IL-13 ELISA KIT

CSB-E04601h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Interleukin 13, IL-13 in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Interleukin 13, IL-13 ELISA KIT

1-CSB-E04601h
  • EUR 603.00
  • EUR 4247.00
  • EUR 2260.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Interleukin 13, IL-13 in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human IL-13(Interleukin 13) ELISA Kit

EH3266 96T
EUR 476.25
  • Detection range: 15.625-1000 pg/ml
  • Uniprot ID: P35225
  • Alias: IL-13(Interleukin 13)/BHR1interleukin-13
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 9.375pg/ml

Human Interleukin 13,IL-13 ELISA KIT

CN-03217H1 96T
EUR 434

Human Interleukin 13,IL-13 ELISA KIT

CN-03217H2 48T
EUR 284

Human cytokeratin 13(CK-13)ELISA Kit

GA-E1624HM-48T 48T
EUR 289

Human cytokeratin 13(CK-13)ELISA Kit

GA-E1624HM-96T 96T
EUR 466

Human Interleukin 13(IL-13)ELISA Kit

GA-E0138HM-48T 48T
EUR 289

Human Interleukin 13(IL-13)ELISA Kit

GA-E0138HM-96T 96T
EUR 466

Human Interleukin-13 (IL-13) ELISA Kit

LF-EK60050 1×96T
EUR 790

Human cytokeratin 13(CK-13)ELISA Kit

QY-E00980 96T
EUR 361

Human Interleukin 13(IL-13)ELISA Kit

QY-E04326 96T
EUR 361

Human ADAMTS -13(ADAMTS -13) ELISA Kit

QY-E05516 96T
EUR 361

KLK13 Rabbit pAb

A14274-100ul 100 ul
EUR 308

KLK13 Rabbit pAb

A14274-200ul 200 ul
EUR 459

KLK13 Rabbit pAb

A14274-20ul 20 ul
EUR 183

KLK13 Rabbit pAb

A14274-50ul 50 ul
EUR 223

KLK13 Blocking Peptide

33R-9689 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KLK13 antibody, catalog no. 70R-3265

KLK13 cloning plasmid

CSB-CL891952HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 834
  • Sequence: atgtggcccctggccctagtgatcgcctccctgaccttggccttgtcaggaggtgtctcccaggagtcttccaaggttctcaacaccaatgggaccagtgggtttctcccaggtggctacacctgcttcccccactctcagccctggcaggctgccctactagtgcaagggcggct
  • Show more
Description: A cloning plasmid for the KLK13 gene.

KLK13 Conjugated Antibody

C36578 100ul
EUR 397

KLK13 Polyclonal Antibody

ABP59062-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human KLK13 protein
  • Applications tips:
Description: A polyclonal antibody for detection of KLK13 from Human. This KLK13 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human KLK13 protein

KLK13 Polyclonal Antibody

ABP59062-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human KLK13 protein
  • Applications tips:
Description: A polyclonal antibody for detection of KLK13 from Human. This KLK13 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human KLK13 protein

KLK13 Polyclonal Antibody

ABP59062-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human KLK13 protein
  • Applications tips:
Description: A polyclonal antibody for detection of KLK13 from Human. This KLK13 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human KLK13 protein

KLK13 Polyclonal Antibody

ES11092-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against KLK13 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

KLK13 Polyclonal Antibody

ES11092-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against KLK13 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-KLK13 antibody

STJ116486 100 µl
EUR 277
Description: Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Expression of this gene is regulated by steroid hormones and may be useful as a marker for breast cancer. An additional transcript variant has been identified, but its full length sequence has not been determined.

Anti-KLK13 antibody

STJ192250 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to KLK13

Human Kallikrein 1 (KLK1) ELISA Kit

DLR-KLK1-Hu-48T 48T
EUR 441
  • Should the Human Kallikrein 1 (KLK1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Kallikrein 1 (KLK1) in samples from serum, plasma or other biological fluids.

Human Kallikrein 1 (KLK1) ELISA Kit

DLR-KLK1-Hu-96T 96T
EUR 570
  • Should the Human Kallikrein 1 (KLK1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Kallikrein 1 (KLK1) in samples from serum, plasma or other biological fluids.

Human Kallikrein 10 (KLK10) ELISA Kit

DLR-KLK10-Hu-48T 48T
EUR 388
  • Should the Human Kallikrein 10 (KLK10) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Kallikrein 10 (KLK10) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Kallikrein 10 (KLK10) ELISA Kit

DLR-KLK10-Hu-96T 96T
EUR 496
  • Should the Human Kallikrein 10 (KLK10) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Kallikrein 10 (KLK10) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Kallikrein 11 (KLK11) ELISA Kit

DLR-KLK11-Hu-48T 48T
EUR 479
  • Should the Human Kallikrein 11 (KLK11) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Kallikrein 11 (KLK11) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Kallikrein 11 (KLK11) ELISA Kit

DLR-KLK11-Hu-96T 96T
EUR 621
  • Should the Human Kallikrein 11 (KLK11) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Kallikrein 11 (KLK11) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Kallikrein 12 (KLK12) ELISA Kit

DLR-KLK12-Hu-48T 48T
EUR 517
  • Should the Human Kallikrein 12 (KLK12) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human Kallikrein 12 (KLK12) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Kallikrein 12 (KLK12) ELISA Kit

DLR-KLK12-Hu-96T 96T
EUR 673
  • Should the Human Kallikrein 12 (KLK12) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human Kallikrein 12 (KLK12) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Kallikrein 14 (KLK14) ELISA Kit

DLR-KLK14-Hu-48T 48T
EUR 517
  • Should the Human Kallikrein 14 (KLK14) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Kallikrein 14 (KLK14) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Kallikrein 14 (KLK14) ELISA Kit

DLR-KLK14-Hu-96T 96T
EUR 673
  • Should the Human Kallikrein 14 (KLK14) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Kallikrein 14 (KLK14) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Kallikrein 2 (KLK2) ELISA Kit

DLR-KLK2-Hu-48T 48T
EUR 517
  • Should the Human Kallikrein 2 (KLK2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Kallikrein 2 (KLK2) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Kallikrein 2 (KLK2) ELISA Kit

DLR-KLK2-Hu-96T 96T
EUR 673
  • Should the Human Kallikrein 2 (KLK2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Kallikrein 2 (KLK2) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Kallikrein 3 (KLK3) ELISA Kit

DLR-KLK3-Hu-48T 48T
EUR 376
  • Should the Human Kallikrein 3 (KLK3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Kallikrein 3 (KLK3) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Kallikrein 3 (KLK3) ELISA Kit

DLR-KLK3-Hu-96T 96T
EUR 480
  • Should the Human Kallikrein 3 (KLK3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Kallikrein 3 (KLK3) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Kallikrein 4 (KLK4) ELISA Kit

DLR-KLK4-Hu-48T 48T
EUR 479
  • Should the Human Kallikrein 4 (KLK4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Kallikrein 4 (KLK4) in samples from serum, plasma or other biological fluids.

Human Kallikrein 4 (KLK4) ELISA Kit

DLR-KLK4-Hu-96T 96T
EUR 621
  • Should the Human Kallikrein 4 (KLK4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Kallikrein 4 (KLK4) in samples from serum, plasma or other biological fluids.

Human Kallikrein 5 (KLK5) ELISA Kit

DLR-KLK5-Hu-48T 48T
EUR 479
  • Should the Human Kallikrein 5 (KLK5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Kallikrein 5 (KLK5) in samples from serum, plasma, saliva, tissue homogenates or other biological fluids.

Human Kallikrein 5 (KLK5) ELISA Kit

DLR-KLK5-Hu-96T 96T
EUR 621
  • Should the Human Kallikrein 5 (KLK5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Kallikrein 5 (KLK5) in samples from serum, plasma, saliva, tissue homogenates or other biological fluids.

Human Kallikrein 6 (KLK6) ELISA Kit

DLR-KLK6-Hu-48T 48T
EUR 479
  • Should the Human Kallikrein 6 (KLK6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Kallikrein 6 (KLK6) in samples from serum, plasma, tissue homogenates, cerebrospinal fluid, breast milk or other biological fluids.

Human Kallikrein 6 (KLK6) ELISA Kit

DLR-KLK6-Hu-96T 96T
EUR 621
  • Should the Human Kallikrein 6 (KLK6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Kallikrein 6 (KLK6) in samples from serum, plasma, tissue homogenates, cerebrospinal fluid, breast milk or other biological fluids.

Human Kallikrein 7 (KLK7) ELISA Kit

DLR-KLK7-Hu-48T 48T
EUR 441
  • Should the Human Kallikrein 7 (KLK7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Kallikrein 7 (KLK7) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Kallikrein 7 (KLK7) ELISA Kit

DLR-KLK7-Hu-96T 96T
EUR 570
  • Should the Human Kallikrein 7 (KLK7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Kallikrein 7 (KLK7) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Kallikrein 8 (KLK8) ELISA Kit

DLR-KLK8-Hu-48T 48T
EUR 479
  • Should the Human Kallikrein 8 (KLK8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Kallikrein 8 (KLK8) in samples from serum, plasma or other biological fluids.

Human Kallikrein 8 (KLK8) ELISA Kit

DLR-KLK8-Hu-96T 96T
EUR 621
  • Should the Human Kallikrein 8 (KLK8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Kallikrein 8 (KLK8) in samples from serum, plasma or other biological fluids.

Human Kallikrein 9 (KLK9) ELISA Kit

DLR-KLK9-Hu-48T 48T
EUR 479
  • Should the Human Kallikrein 9 (KLK9) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Kallikrein 9 (KLK9) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Kallikrein 9 (KLK9) ELISA Kit

DLR-KLK9-Hu-96T 96T
EUR 621
  • Should the Human Kallikrein 9 (KLK9) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Kallikrein 9 (KLK9) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human plasma kallikrein(KLKB1) ELISA kit

E01P0813-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human plasma kallikrein(KLKB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human plasma kallikrein(KLKB1) ELISA kit

E01P0813-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human plasma kallikrein(KLKB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human plasma kallikrein(KLKB1) ELISA kit

E01P0813-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human plasma kallikrein(KLKB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 3 (KLK3) ELISA Kit

abx050133-96tests 96 tests
EUR 770
  • Shipped within 5-10 working days.

Human Kallikrein 1 (KLK1) ELISA Kit

20-abx152081
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Kallikrein 10 (KLK10) ELISA Kit

20-abx152082
  • EUR 5311.00
  • EUR 2837.00
  • EUR 668.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Kallikrein 11 (KLK11) ELISA Kit

20-abx152083
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Kallikrein 12 (KLK12) ELISA Kit

20-abx152084
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Kallikrein 14 (KLK14) ELISA Kit

20-abx152087
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Kallikrein 2 (KLK2) ELISA Kit

20-abx152088
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Kallikrein 3 (KLK3) ELISA Kit

20-abx152089
  • EUR 5311.00
  • EUR 2837.00
  • EUR 668.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Kallikrein 5 (KLK5) ELISA Kit

20-abx152090
  • EUR 5640.00
  • EUR 3009.00
  • EUR 707.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Kallikrein 6 (KLK6) ELISA Kit

20-abx152091
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Kallikrein 6 (KLK6) ELISA Kit

20-abx152092
  • EUR 6439.00
  • EUR 3432.00
  • EUR 801.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Kallikrein 7 (KLK7) ELISA Kit

20-abx152093
  • EUR 6173.00
  • EUR 3291.00
  • EUR 770.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Kallikrein 8 (KLK8) ELISA Kit

20-abx152095
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Kallikrein 9 (KLK9) ELISA Kit

20-abx152096
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Kallikrein 8 (KLK8) ELISA Kit

abx250247-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Kallikrein 7 (KLK7) ELISA Kit

abx251319-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Kallikrein 14 (KLK14) ELISA Kit

abx251389-96tests 96 tests
EUR 637
  • Shipped within 5-12 working days.

Human Kallikrein 6 (KLK6) ELISA Kit

abx251410-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Kallikrein 1 (KLK1) ELISA Kit

abx251453-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Human Kallikrein 5 (KLK5) ELISA Kit

abx251464-96tests 96 tests
EUR 637
  • Shipped within 5-12 working days.

ELISA kit for Human Kallikrein 3

EK5362 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Kallikrein 3 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Kallikrein 14

EK5428 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Kallikrein 14 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Kallikrein-8

EK2128 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Kallikrein-8 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Kallikrein-6

EK2130 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Kallikrein-6 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Kallikrein-10

EK2137 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Kallikrein-10 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Kallikrein-1

EK2486 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Kallikrein-1 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Kallikrein-5

EK2862 96 tests
EUR 452
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Kallikrein-5 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Kallikrein-7

EK4077 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Kallikrein-7 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human Kallikrein 3 PicoKine ELISA Kit

EK0816 96 wells
EUR 456
Description: For quantitative detection of Human Kallikrein 3 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human Kallikrein-6 PicoKine ELISA Kit

EK0818 96 wells
EUR 425
Description: For quantitative detection of human Kallikrein-6 in cell culture supernates, cell lysates, serum and plasma(heparin, EDTA) .

Human Kallikrein 14 PicoKine ELISA Kit

EK0949 96 wells
EUR 425
Description: For quantitative detection of human Kallikrein 14 in cell culture supernates, cell lysates, serum and plasma(heparin, EDTA).

Human KLK1/ Kallikrein-1 ELISA Kit

E1385Hu 1 Kit
EUR 571

Human KLK10/ Kallikrein-10 ELISA Kit

E1386Hu 1 Kit
EUR 571

Human KLK11/ Kallikrein-11 ELISA Kit

E1387Hu 1 Kit
EUR 571

Human KLK2/ Kallikrein-2 ELISA Kit

E1388Hu 1 Kit
EUR 571

Human KLK5/ Kallikrein-5 ELISA Kit

E1390Hu 1 Kit
EUR 537

Human KLK6/ Kallikrein-6 ELISA Kit

E1391Hu 1 Kit
EUR 571

Human KLK7/ Kallikrein-7 ELISA Kit

E1392Hu 1 Kit
EUR 571

Human KLK8/ Kallikrein-8 ELISA Kit

E1393Hu 1 Kit
EUR 571

Human KLK9/ Kallikrein-9 ELISA Kit

E1394Hu 1 Kit
EUR 571

Human KLK6(Kallikrein-6) ELISA Kit

EH0208 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: Q92876
  • Alias: KLK6/Kallikrein-6/Bssp/PRSS18/PRSS9/SP59/hK6/ZYME
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human KLK1(Kallikrein-1) ELISA Kit

EH0212 96T
EUR 567.6
  • Detection range: 0.312-20 ng/ml
  • Uniprot ID: P06870
  • Alias: KLK1/KLK1/Kallikrein-1/Kidney/pancreas/salivary gland kallikrein/Tissue kallikrein
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human KLK5(Kallikrein-5) ELISA Kit

EH0213 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q9Y337
  • Alias: KLK5/Kallikrein-like protein 2(KLK-L2)/Stratum corneum tryptic enzyme
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human KLK2(Kallikrein-2) ELISA Kit

EH0818 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P20151
  • Alias: KLK2(Kallikrein-2)/Glandular kallikrein-1(hGK-1)/Tissue kallikrein-2
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human KLK13(Kallikrein 13) ELISA Kit