Human EDA2R(Ectodysplasin A2 Receptor) ELISA Kit

To Order: Contact

Human Ectodysplasin A2 Receptor (EDA2R) ELISA Kit
SED931Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ectodysplasin A2 Receptor (EDA2R) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ectodysplasin A2 Receptor (EDA2R) in Tissue homogenates, cell lysates and other biological fluids.

Human Ectodysplasin A2 Receptor (EDA2R) ELISA Kit
SED931Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ectodysplasin A2 Receptor (EDA2R) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ectodysplasin A2 Receptor (EDA2R) in Tissue homogenates, cell lysates and other biological fluids.

Human Ectodysplasin A2 Receptor (EDA2R) ELISA Kit
SED931Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ectodysplasin A2 Receptor (EDA2R) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ectodysplasin A2 Receptor (EDA2R) in Tissue homogenates, cell lysates and other biological fluids.

Human Ectodysplasin A2 Receptor (EDA2R) ELISA Kit
4-SED931Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Ectodysplasin A2 Receptor elisa. Alternative names of the recognized antigen: XEDAR EDA-A2R EDAA2R TNFRSF27 X-linked ectodysplasin-A2 receptor
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Ectodysplasin A2 Receptor (EDA2R) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Ectodysplasin A2 Receptor (EDA2R) Antibody
20-abx176222	Abbexa	EUR 1205.00 EUR 578.00	1 mg 200 ug
Please enquire.

Ectodysplasin A2 Receptor (EDA2R) Antibody
20-abx211084	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Ectodysplasin A2 Receptor (EDA2R) Antibody
20-abx211229	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Ectodysplasin A2 Receptor (EDA2R) Antibody
20-abx172191	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Ectodysplasin A2 Receptor (EDA2R) Antibody
abx030265-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Ectodysplasin A2 Receptor (EDA2R) Antibody
abx030265-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Ectodysplasin A2 Receptor (EDA2R) Antibody
20-abx320461	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Ectodysplasin A2 Receptor (EDA2R) Antibody
20-abx321616	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Human Ectodysplasin A2 Receptor (EDA2R) Protein
20-abx653233	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Mouse Ectodysplasin A2 Receptor (EDA2R) ELISA Kit
abx389133-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Ectodysplasin A2 Receptor (EDA2R) CLIA Kit
20-abx494438	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human EDA2R (Ectodysplasin A2 Receptor)
ELK5111	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Ectodysplasin A2 Receptor (EDA2R). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Show more
Description: A sandwich ELISA kit for detection of Ectodysplasin A2 Receptor from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

EDA2R Ectodysplasin A2 Receptor Human Recombinant Protein
PROTQ9HAV5	BosterBio	Regular: 20ug	EUR 317
Description: EDA2R Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 161 amino acids (1-138 a.a) and having a molecular mass of 17.7kDa.

EDA2R Human, Ectodysplasin A2 Receptor Human Recombinant Protein, Sf9
PROTQ9HAV5-1	BosterBio	Regular: 10ug	EUR 317
Description: EDA2R Human Recombinant produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 380 amino acids (1-138a.a.) and having a molecular mass of 42.5kDa (Molecular size on SDS-PAGE will appear at approximately 40-57kDa). EDA2R is expressed with a 242 amino acid hIgG-His tag at C-Terminus and purified by proprietary chromatographic techniques.

Recombinant Mouse Ectodysplasin A2 Receptor/EDA2R/TNFRSF27 (C-Fc)
CM43-10ug	Novoprotein	10ug	EUR 126
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Recombinant Mouse Ectodysplasin A2 Receptor/EDA2R/TNFRSF27 (C-Fc)
CM43-1mg	Novoprotein	1mg	EUR 1877
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Recombinant Mouse Ectodysplasin A2 Receptor/EDA2R/TNFRSF27 (C-Fc)
CM43-500ug	Novoprotein	500ug	EUR 1328
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Recombinant Mouse Ectodysplasin A2 Receptor/EDA2R/TNFRSF27 (C-Fc)
CM43-50ug	Novoprotein	50ug	EUR 232
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Recombinant Mouse Ectodysplasin A2 Receptor/EDA2R/TNFRSF27 (C-6His)
CM44-10ug	Novoprotein	10ug	EUR 126
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Recombinant Mouse Ectodysplasin A2 Receptor/EDA2R/TNFRSF27 (C-6His)
CM44-1mg	Novoprotein	1mg	EUR 1877
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Recombinant Mouse Ectodysplasin A2 Receptor/EDA2R/TNFRSF27 (C-6His)
CM44-500ug	Novoprotein	500ug	EUR 1328
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Recombinant Mouse Ectodysplasin A2 Receptor/EDA2R/TNFRSF27 (C-6His)
CM44-50ug	Novoprotein	50ug	EUR 232
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Ectodysplasin A2 Receptor Protein
20-abx261191	Abbexa	EUR 3418.00 EUR 328.00 EUR 230.00	1 mg 20 ug 5 ug
Shipped within 5-10 working days.

EDA2R ELISA KIT|Human
EF004889	Lifescience Market	96 Tests	EUR 689

Human EDA2R ELISA KIT
ELI-51897h	Lifescience Market	96 Tests	EUR 824

Ectodysplasin A Receptor antibody
70R-7548	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal Ectodysplasin A Receptor antibody raised against the middle region of EDAR

EDA2R ELISA Kit (Human) (OKCD01792)
OKCD01792	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: Receptor for EDA isoform A2, but not for EDA isoform A1. Mediates the activation of the NF-kappa-B and JNK pathways. Activation seems to be mediated by binding to TRAF3 and TRAF6.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.056 ng/mL

Human Ectodysplasin-A ELISA kit
E01E0400-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Ectodysplasin-A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ectodysplasin-A ELISA kit
E01E0400-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Ectodysplasin-A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ectodysplasin-A ELISA kit
E01E0400-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Ectodysplasin-A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Eda2r ELISA KIT
ELI-45588m	Lifescience Market	96 Tests	EUR 865

Human Ectodysplasin A (EDA) ELISA Kit
abx251354-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

ELISA kit for Human Ectodysplasin-A
EK4144	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Ectodysplasin-A in samples from serum, plasma, tissue homogenates and other biological fluids.

Human EDA/ Ectodysplasin-A ELISA Kit
E0754Hu	Sunlong	1 Kit	EUR 571

Human EDA(Ectodysplasin-A) ELISA Kit
EH2028	FN Test	96T	EUR 567.6
Detection range: 78-5000 pg/ml Uniprot ID: Q92838 Alias: EDA(Ectodysplasin-A)/EDA protein homolog/Tabby protein/ED1/HED/EDA1/EDA2/HED1/ODT1/XHED/ECTD1/XLHED/ED1-A1/ED1-A2/EDA-A1/EDA-A2/STHAGX1/Ectodermal dysplasia protein
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml

Human Ectodysplasin- A, EDA ELISA KIT
ELI-06345h	Lifescience Market	96 Tests	EUR 824

Human Ectodysplasin A(EDA)ELISA Kit
QY-E01122	Qayee Biotechnology	96T	EUR 400

Ectodysplasin A Receptor Blocking Peptide
33R-6971	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EDAR antibody, catalog no. 70R-7548

Ectodysplasin A Receptor (EDAR) Antibody
20-abx003336	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Ectodysplasin A Receptor (EDAR) Antibody
abx232629-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Rat Ectodysplasin-A ELISA kit
E02E0400-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Ectodysplasin-A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Ectodysplasin-A ELISA kit
E02E0400-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Ectodysplasin-A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Ectodysplasin-A ELISA kit
E02E0400-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Ectodysplasin-A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Ectodysplasin-A ELISA kit
E03E0400-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Ectodysplasin-A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Ectodysplasin-A ELISA kit
E03E0400-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Ectodysplasin-A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Ectodysplasin-A ELISA kit
E03E0400-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Ectodysplasin-A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Ectodysplasin-A ELISA kit
E06E0400-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Ectodysplasin-A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Ectodysplasin-A ELISA kit
E06E0400-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Ectodysplasin-A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Ectodysplasin-A ELISA kit
E06E0400-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Ectodysplasin-A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Ectodysplasin-A ELISA kit
E04E0400-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Ectodysplasin-A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Ectodysplasin-A ELISA kit
E04E0400-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Ectodysplasin-A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Ectodysplasin-A ELISA kit
E04E0400-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Ectodysplasin-A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Ectodysplasin-A ELISA kit
E09E0400-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Ectodysplasin-A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Ectodysplasin-A ELISA kit
E09E0400-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Ectodysplasin-A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Ectodysplasin-A ELISA kit
E09E0400-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Ectodysplasin-A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Ectodysplasin-A ELISA kit
E08E0400-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Ectodysplasin-A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Ectodysplasin-A ELISA kit
E08E0400-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Ectodysplasin-A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Ectodysplasin-A ELISA kit
E08E0400-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Ectodysplasin-A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Ectodysplasin-A ELISA kit
E07E0400-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Ectodysplasin-A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Ectodysplasin-A ELISA kit
E07E0400-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Ectodysplasin-A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Ectodysplasin-A ELISA kit
E07E0400-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Ectodysplasin-A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Eda2r ELISA Kit| Mouse Tumor necrosis factor receptor superfami
EF014763	Lifescience Market	96 Tests	EUR 689

Edaradd ELISA Kit| Mouse Ectodysplasin-A receptor-associated ad
EF014766	Lifescience Market	96 Tests	EUR 689

EDAR Ectodysplasin A Receptor Human Recombinant Protein
PROTQ9UNE0	BosterBio	Regular: 20ug	EUR 317
Description: EDAR Human Recombinant produced in E.Coli is a single,non-glycosylated polypeptide chain containing 445 amino acids (27-448 a.a) andhaving a molecular mass of 48.2kDa. EDAR is fused to a 23 amino acid His-tag at N-terminus& purified by proprietary chromatographic techniques.

Human EPH Receptor A2 (EPHA2) ELISA Kit
abx252400-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-12 working days.

Human Thromboxane A2 Receptor (TXA2R) ELISA Kit
abx253296-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human Thromboxane A2 receptor, TBXA2R ELISA KIT
ELI-18790h	Lifescience Market	96 Tests	EUR 824

EDA2R Antibody
36434-100ul	SAB	100ul	EUR 252

EDA2R Antibody
1-CSB-PA640379	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against EDA2R. Recognizes EDA2R from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

EDA2R Antibody
1-CSB-PA881011ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against EDA2R. Recognizes EDA2R from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

EDA2R Antibody
1-CSB-PA881011ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against EDA2R. Recognizes EDA2R from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

EDA2R Antibody
1-CSB-PA025575	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against EDA2R. Recognizes EDA2R from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:200-1:1000, IHC:1:50-1:200

EDA2R siRNA
20-abx914936	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

EDA2R siRNA
20-abx914937	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-EDA2R
YF-PA20363	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to EDA2R

anti-EDA2R
YF-PA20364	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to EDA2R

anti-EDA2R
YF-PA20365	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to EDA2R

anti-EDA2R
YF-PA26525	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to EDA2R

Mouse Eda/ Ectodysplasin-A ELISA Kit
E0441Mo	Sunlong	1 Kit	EUR 571

Guinea pig Ectodysplasin-A ELISA kit
E05E0400-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Ectodysplasin-A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Ectodysplasin-A ELISA kit
E05E0400-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Ectodysplasin-A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Ectodysplasin-A ELISA kit
E05E0400-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Ectodysplasin-A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Ectodysplasin A (EDA) ELISA Kit
abx255053-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

ELISA kit for Mouse Ectodysplasin-A
EK4143	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Ectodysplasin-A in samples from serum, plasma, tissue homogenates and other biological fluids.

Mouse Ectodysplasin- A, Eda ELISA KIT
ELI-06346m	Lifescience Market	96 Tests	EUR 865

Bovine Ectodysplasin- A, EDA ELISA KIT
ELI-06347b	Lifescience Market	96 Tests	EUR 928

Mouse Ectodysplasin-A(EDA) ELISA kit
CSB-EL007389MO-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Ectodysplasin-A (EDA) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Ectodysplasin-A(EDA) ELISA kit
1-CSB-EL007389MO	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Ectodysplasin-A(EDA) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Cow Ectodysplasin A (EDA) ELISA Kit
abx519005-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Ectodysplasin A (EDA) ELISA Kit
abx519007-96tests	Abbexa	96 tests	EUR 746
Shipped within 5-12 working days.

Mouse Eda(Ectodysplasin-A) ELISA Kit
EM0705	FN Test	96T	EUR 567.6
Detection range: 0.156-10 ng/ml Uniprot ID: O54693 Alias: Eda/EDA protein homolog/Tabby protein/ED1/HED/EDA1/EDA2/HED1/ODT1/XHED/ECTD1/XLHED/ED1-A1/ED1-A2/EDA-A1/EDA-A2/STHAGX1/Ectodermal dysplasia protein
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.094 ng/ml

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

ELISA kit for Human Tumor necrosis factor receptor superfamily member 27 (EDA2R)
KTE61954-48T	Abbkine	48T	EUR 332
EDA-A1 and EDA-A2 are two isoforms of ectodysplasin that are encoded by the anhidrotic ectodermal dysplasia (EDA) gene. Mutations in EDA give rise to a clinical syndrome characterized by loss of hair, sweat glands, and teeth. The protein encoded by t Show more
Description: Quantitative sandwich ELISA for measuring Human Tumor necrosis factor receptor superfamily member 27 (EDA2R) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Tumor necrosis factor receptor superfamily member 27 (EDA2R)
KTE61954-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
EDA-A1 and EDA-A2 are two isoforms of ectodysplasin that are encoded by the anhidrotic ectodermal dysplasia (EDA) gene. Mutations in EDA give rise to a clinical syndrome characterized by loss of hair, sweat glands, and teeth. The protein encoded by t Show more
Description: Quantitative sandwich ELISA for measuring Human Tumor necrosis factor receptor superfamily member 27 (EDA2R) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Tumor necrosis factor receptor superfamily member 27 (EDA2R)
KTE61954-96T	Abbkine	96T	EUR 539
EDA-A1 and EDA-A2 are two isoforms of ectodysplasin that are encoded by the anhidrotic ectodermal dysplasia (EDA) gene. Mutations in EDA give rise to a clinical syndrome characterized by loss of hair, sweat glands, and teeth. The protein encoded by t Show more
Description: Quantitative sandwich ELISA for measuring Human Tumor necrosis factor receptor superfamily member 27 (EDA2R) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human EDA2R shRNA Plasmid
20-abx961790	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

EDA2R Recombinant Protein (Human)
RP010147	ABM	100 ug	Ask for price

EDA ELISA Kit| Bovine Ectodysplasin-A ELISA Kit
EF011342	Lifescience Market	96 Tests	EUR 689

Eda ELISA Kit| Mouse Ectodysplasin-A ELISA Kit
EF013318	Lifescience Market	96 Tests	EUR 689

Human Phospholipase A2 Receptor 1 (PLA2R1)ELISA kit
201-12-2528	SunredBio	96 tests	EUR 440
This Phospholipase A2 Receptor 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Phospholipase A2 Receptor 1 (PLA2R1) ELISA Kit
DLR-PLA2R1-Hu-48T	DL Develop	48T	EUR 517
Should the Human Phospholipase A2 Receptor 1 (PLA2R1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Phospholipase A2 Receptor 1 (PLA2R1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Phospholipase A2 Receptor 1 (PLA2R1) ELISA Kit
DLR-PLA2R1-Hu-96T	DL Develop	96T	EUR 673
Should the Human Phospholipase A2 Receptor 1 (PLA2R1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Phospholipase A2 Receptor 1 (PLA2R1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Phospholipase A2 Receptor 1 (PLA2R1) ELISA Kit
20-abx152764	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Phospholipase A2 Receptor 1 (PLA2R1) ELISA Kit
abx251380-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-12 working days.

ELISA kit for Human Secretory phospholipase A2 receptor
EK4191	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Secretory phospholipase A2 receptor in samples from serum, plasma, tissue homogenates and other biological fluids.

Human PLA2R1/ Secretory phospholipase A2 receptor ELISA Kit
E1955Hu	Sunlong	1 Kit	EUR 571

Human PLA2R1(Secretory phospholipase A2 receptor) ELISA Kit
EH2051	FN Test	96T	EUR 524.1
Detection range: 0.156-10 ng/ml Uniprot ID: Q13018 Alias: PLA2R1(Secretory phospholipase A2 receptor)/CLEC13C/PLA2G1R/CLEC13CC-type lectin domain family 13 member C/phospholipase A2 receptor 1, 180kDa/PLA2IR/PLA2-RM-type receptor
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Secretory phospholipase A2 receptor, PLA2R1 ELISA KIT
ELI-06488h	Lifescience Market	96 Tests	EUR 824

Human Phospholipidase A2 Receptor antibody (IgG) ELISA Kit
CSB-E13287h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Qualitativeindirect ELISA kit for measuring Human Phospholipidase A2 Receptor antibody (IgG) in samples from serum. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Phospholipidase A2 Receptor antibody (IgG) ELISA Kit
1-CSB-E13287h	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Qualitativeindirect ELISA kit for measuring Human Phospholipidase A2 Receptor antibody (IgG) in samples from serum. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Secretory phospholipase A2 receptor (PLA2R1) ELISA Kit
abx571020-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Phospholipase A2 Receptor 1(PLA2R1)ELISA Kit
QY-E02289	Qayee Biotechnology	96T	EUR 361

Human Phospholipase A2 Receptor 1 ELISA Kit (PLA2R1)
RK02098	Abclonal	96 Tests	EUR 521

Human Phospholipase A2 Receptor 1 (PLA2R1) ELISA Kit
SED851Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Phospholipase A2 Receptor 1 (PLA2R1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Phospholipase A2 Receptor 1 (PLA2R1) in serum, plasma, tissue homogenates and other biological fluids.

Human Phospholipase A2 Receptor 1 (PLA2R1) ELISA Kit
SED851Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Phospholipase A2 Receptor 1 (PLA2R1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Phospholipase A2 Receptor 1 (PLA2R1) in serum, plasma, tissue homogenates and other biological fluids.

Human Phospholipase A2 Receptor 1 (PLA2R1) ELISA Kit
SED851Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Phospholipase A2 Receptor 1 (PLA2R1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Phospholipase A2 Receptor 1 (PLA2R1) in serum, plasma, tissue homogenates and other biological fluids.

Human Phospholipase A2 Receptor 1 (PLA2R1) ELISA Kit
SED851Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Phospholipase A2 Receptor 1 (PLA2R1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Phospholipase A2 Receptor 1 (PLA2R1) in serum, plasma, tissue homogenates and other biological fluids.

Human Phospholipase A2 Receptor 1 (PLA2R1) ELISA Kit
4-SED851Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Phospholipase A2 Receptor 1 elisa. Alternative names of the recognized antigen: CLEC13C PLA2G1R PLA2IR PLA2R 180 kDa secretory phospholipase A2 receptor C-type lectin domain family 13 member C Soluble secretory phospholipase A2 re Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Phospholipase A2 Receptor 1 (PLA2R1) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Phospholipase A2 Receptor 1 (PLA2R1) ELISA Kit
RDR-PLA2R1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Phospholipase A2 Receptor 1 (PLA2R1) ELISA Kit
RDR-PLA2R1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Phospholipase A2 Receptor 1 (PLA2R1) ELISA Kit
RD-PLA2R1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Phospholipase A2 Receptor 1 (PLA2R1) ELISA Kit
RD-PLA2R1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Recombinant Mouse Ectodysplasin Receptor/EDAR (C-Fc)
CK76-10ug	Novoprotein	10ug	EUR 146
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH 7.4.

Recombinant Mouse Ectodysplasin Receptor/EDAR (C-Fc)
CK76-1mg	Novoprotein	1mg	EUR 2283
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH 7.4.

Recombinant Mouse Ectodysplasin Receptor/EDAR (C-Fc)
CK76-500ug	Novoprotein	500ug	EUR 1613
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH 7.4.

Recombinant Mouse Ectodysplasin Receptor/EDAR (C-Fc)
CK76-50ug	Novoprotein	50ug	EUR 303
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH 7.4.

Human Phospholipidase A2,PL-A2 ELISA Kit
201-12-0926	SunredBio	96 tests	EUR 440
This Phospholipidase A2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Thromboxane A2,TX-A2 ELISA Kit
201-12-1167	SunredBio	96 tests	EUR 440
This Thromboxane A2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Apolipoprotein A2, apo-A2 ELISA Kit
CSB-E13504h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Apolipoprotein A2, apo-A2 in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Apolipoprotein A2, apo-A2 ELISA Kit
1-CSB-E13504h	Cusabio	EUR 900.00 EUR 5476.00 EUR 2900.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Apolipoprotein A2, apo-A2 in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Phospholipidase A2,PL-A2 ELISA Kit
CN-03323H1	ChemNorm	96T	EUR 439

Human Phospholipidase A2,PL-A2 ELISA Kit
CN-03323H2	ChemNorm	48T	EUR 290

Human Thromboxane A2,TX-A2 ELISA Kit
CN-04093H1	ChemNorm	96T	EUR 438

Human Thromboxane A2,TX-A2 ELISA Kit
CN-04093H2	ChemNorm	48T	EUR 289

Human Phospholipidase A2(PL-A2)ELISA Kit
GA-E0942HM-48T	GenAsia Biotech	48T	EUR 289

Human Phospholipidase A2(PL-A2)ELISA Kit
GA-E0942HM-96T	GenAsia Biotech	96T	EUR 466

Human Thromboxane A2(TX-A2)ELISA Kit
GA-E1183HM-48T	GenAsia Biotech	48T	EUR 289

Human Thromboxane A2(TX-A2)ELISA Kit
GA-E1183HM-96T	GenAsia Biotech	96T	EUR 466

Human Apolipoprotein A2(APO-A2)ELISA Kit
QY-E00337	Qayee Biotechnology	96T	EUR 394

Human Thromboxane A2(TX-A2)ELISA Kit
QY-E00645	Qayee Biotechnology	96T	EUR 361

Human Phospholipidase A2(PL-A2)ELISA Kit
QY-E02291	Qayee Biotechnology	96T	EUR 400

Bovine Thromboxane A2 receptor, TBXA2R ELISA KIT
ELI-13724b	Lifescience Market	96 Tests	EUR 928

Mouse Thromboxane A2 receptor, Tbxa2r ELISA KIT
ELI-53077m	Lifescience Market	96 Tests	EUR 865

Monkey EPH Receptor A2 (EPHA2) ELISA Kit
abx360311-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Pig Thromboxane A2 Receptor (TXA2R) ELISA Kit
abx360632-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Pig EPH Receptor A2 (EPHA2) ELISA Kit
abx362044-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rabbit EPH Receptor A2 (EPHA2) ELISA Kit
abx363288-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Chicken EPH Receptor A2 (EPHA2) ELISA Kit
abx356840-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Monkey Thromboxane A2 Receptor (TXA2R) ELISA Kit
abx358965-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Chicken Thromboxane A2 Receptor (TXA2R) ELISA Kit
abx355582-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rabbit Thromboxane A2 Receptor (TXA2R) ELISA Kit
abx363607-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

EDA2R Conjugated Antibody
C36434	SAB	100ul	EUR 397

EDA2R cloning plasmid
CSB-CL881011HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 894 Sequence: atggattgccaagaaaatgagtactgggaccaatggggacggtgtgtcacctgccaacggtgtggtcctggacaggagctatccaaggattgtggttatggagagggtggagatgcctactgcacagcctgccctcctcgcaggtacaaaagcagctggggccaccacagatgtca Show more
Description: A cloning plasmid for the EDA2R gene.

Anti-EDA2R (3C1)
YF-MA19144	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to EDA2R

Ectodysplasin A antibody
70R-14099	Fitzgerald	100 ug	EUR 322
Description: Affinity purified Rabbit polyclonal Ectodysplasin A antibody

Ectodysplasin A antibody
70R-5943	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal Ectodysplasin A antibody raised against the middle region of EDA

Ectodysplasin A antibody
70R-5969	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal Ectodysplasin A antibody raised against the middle region of EDA

ELISA kit for Human PLA2R1 (Phospholipase A2 Receptor 1)
E-EL-H1062	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's PLA2R1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human PLA2R1. Standards or samples are added to the micro ELISA plate wells and combined wit Show more
Description: A sandwich ELISA kit for quantitative measurement of Human PLA2R1 (Phospholipase A2 Receptor 1) in samples from Serum, Plasma, Cell supernatant

Human Leukocyte Immunoglobulin Like Receptor A2 (LILRA2) ELISA Kit
abx251816-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Human EphA2(Tyrosine protein kinase receptor A2) ELISA Kit
EH3008	FN Test	96T	EUR 524.1
Detection range: 78.125-5000 pg/ml Uniprot ID: P29317 Alias: EphA2/Eck/Myk2/Sek2/ARCC2/EC 2.7.10/EC 2.7.10.1/ECKepithelial cell receptor protein tyrosine kinase/EPH receptor A2/EphA2/ephrin type-A receptor 2/Epithelial cell kinase/soluble EPHA2 varia Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.875pg/ml

ELISA kit for Human PLA2R1 (Phospholipase A2 Receptor 1)
ELK3558	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Phospholipase A2 Receptor 1 (PLA2R1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific Show more
Description: A sandwich ELISA kit for detection of Phospholipase A2 Receptor 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human phospholipase A2 receptor 1, 180kDa (PLA2R1) ELISA kit
CSB-E13155h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human phospholipase A2 receptor 1, 180kDa (PLA2R1) in samples from serum, plasma, tissue homogenates, cell culture supernates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human phospholipase A2 receptor 1, 180kDa (PLA2R1) ELISA kit
1-CSB-E13155h	Cusabio	EUR 900.00 EUR 5476.00 EUR 2900.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human phospholipase A2 receptor 1, 180kDa (PLA2R1) in samples from serum, plasma, tissue homogenates, cell culture supernates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Phospholipidase A2 Receptor Antibody (IgG) (Human) ELISA Kit (OKCA00513)
OKCA00513	Aviva Systems Biology	96 Wells	EUR 859
Description: Description of target: Phospholipidase A2 Receptor Antibody (IgG);Species reactivity: Human;Application: ;Assay info: Assay Methodology: Qualitative Reverse Capture ELISA;Sensitivity:

EDA2R ORF Vector (Human) (pORF)
ORF003383	ABM	1.0 ug DNA	EUR 95

Human soluble Phospholipase A2,sPL-A2 ELISA Kit
201-12-0876	SunredBio	96 tests	EUR 440
This soluble Phospholipase A2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human soluble Phospholipase A2,sPL-A2 ELISA Kit
CN-04617H1	ChemNorm	96T	EUR 458

Human soluble Phospholipase A2,sPL-A2 ELISA Kit
CN-04617H2	ChemNorm	48T	EUR 307

Human soluble Phospholipase A2(sPL-A2)ELISA Kit
GA-E0892HM-48T	GenAsia Biotech	48T	EUR 289

Human soluble Phospholipase A2(sPL-A2)ELISA Kit
GA-E0892HM-96T	GenAsia Biotech	96T	EUR 466

ELISA kit for Human Thromboxane A2 (TX-A2)
KTE62669-48T	Abbkine	48T	EUR 245
Thromboxane A2 (TXA2) is a thromboxane. It is produced by activated platelets and has prothrombotic properties? it stimulates activation of new platelets as well as increases platelet aggregation. This is achieved by mediating expression of the glyco Show more
Description: Quantitative sandwich ELISA for measuring Human Thromboxane A2 (TX-A2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Thromboxane A2 (TX-A2)
KTE62669-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 1523
Thromboxane A2 (TXA2) is a thromboxane. It is produced by activated platelets and has prothrombotic properties? it stimulates activation of new platelets as well as increases platelet aggregation. This is achieved by mediating expression of the glyco Show more
Description: Quantitative sandwich ELISA for measuring Human Thromboxane A2 (TX-A2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Thromboxane A2 (TX-A2)
KTE62669-96T	Abbkine	96T	EUR 398
Thromboxane A2 (TXA2) is a thromboxane. It is produced by activated platelets and has prothrombotic properties? it stimulates activation of new platelets as well as increases platelet aggregation. This is achieved by mediating expression of the glyco Show more
Description: Quantitative sandwich ELISA for measuring Human Thromboxane A2 (TX-A2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human soluble Phospholipase A2(sPL-A2)ELISA Kit
QY-E02463	Qayee Biotechnology	96T	EUR 361

Mouse Secretory phospholipase A2 receptor, Pla2r1 ELISA KIT
ELI-06489m	Lifescience Market	96 Tests	EUR 865

Bovine Secretory phospholipase A2 receptor, PLA2R1 ELISA KIT
ELI-06490b	Lifescience Market	96 Tests	EUR 928

Rabbit Secretory phospholipase A2 receptor, PLA2R1 ELISA KIT
ELI-06491Ra	Lifescience Market	96 Tests	EUR 928

Pig Phospholipase A2 Receptor 1 (PLA2R1) ELISA Kit
abx360893-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Guinea pig Thromboxane A2 Receptor (TXA2R) ELISA Kit
abx357455-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Guinea pig EPH Receptor A2 (EPHA2) ELISA Kit
abx357926-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Monkey Phospholipase A2 Receptor 1 (PLA2R1) ELISA Kit
abx358922-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Chicken Phospholipase A2 Receptor 1 (PLA2R1) ELISA Kit
abx355672-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rabbit Phospholipase A2 Receptor 1 (PLA2R1) ELISA Kit
abx363679-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Sheep Phospholipase A2 Receptor 1 (PLA2R1) ELISA Kit
abx364290-96tests	Abbexa	96 tests	EUR 926
Shipped within 5-12 working days.

Cow Secretory phospholipase A2 receptor (PLA2R1) ELISA Kit
abx519149-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Secretory phospholipase A2 receptor (PLA2R1) ELISA Kit
abx519151-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Rat Phospholipase A2 Receptor 1(PLA2R1)ELISA kit
QY-E10545	Qayee Biotechnology	96T	EUR 413

Mouse Phospholipase A2 Receptor 1(PLA2R1)ELISA kit
QY-E21170	Qayee Biotechnology	96T	EUR 361

Human a2 Microglobulin ELISA kit
E01M0207-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human a2 Microglobulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human EDA2R(Ectodysplasin A2 Receptor) ELISA Kit