Human CPN2(Carboxypeptidase N2) ELISA Kit

To Order: Contact

Human Carboxypeptidase N2 (CPN2)ELISA Kit

201-12-2437 96 tests
EUR 440
  • This Carboxypeptidase N2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Carboxypeptidase N2(CPN2)ELISA Kit

QY-E01341 96T
EUR 361

Human Carboxypeptidase N2 (CPN2) ELISA Kit

SEF324Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carboxypeptidase N2 (CPN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carboxypeptidase N2 (CPN2) in serum, plasma, tissue homogenates and other biological fluids.

Human Carboxypeptidase N2 (CPN2) ELISA Kit

SEF324Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carboxypeptidase N2 (CPN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carboxypeptidase N2 (CPN2) in serum, plasma, tissue homogenates and other biological fluids.

Human Carboxypeptidase N2 (CPN2) ELISA Kit

SEF324Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carboxypeptidase N2 (CPN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carboxypeptidase N2 (CPN2) in serum, plasma, tissue homogenates and other biological fluids.

Human Carboxypeptidase N2 (CPN2) ELISA Kit

SEF324Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carboxypeptidase N2 (CPN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carboxypeptidase N2 (CPN2) in serum, plasma, tissue homogenates and other biological fluids.

Human Carboxypeptidase N2 (CPN2) ELISA Kit

4-SEF324Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Carboxypeptidase N2 elisa. Alternative names of the recognized antigen: ACBP
  • Carboxypeptidase N 83 kDa chain
  • Carboxypeptidase N large subunit
  • Carboxypeptidase N regulatory subunit
  • Carboxypeptidase N polypeptide 2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Carboxypeptidase N2 (CPN2) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Carboxypeptidase N2 (CPN2) Antibody

20-abx129010
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Carboxypeptidase N2 (CPN2) Antibody

abx027272-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Carboxypeptidase N2 (CPN2) Antibody

abx027272-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Carboxypeptidase N2 (CPN2) Antibody

20-abx014322
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Carboxypeptidase N2 (CPN2) Antibody

20-abx175702
  • EUR 1302.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

Carboxypeptidase N2 (CPN2) Antibody

20-abx323544
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Carboxypeptidase N2 (CPN2) Antibody

abx330718-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Carboxypeptidase N2 (CPN2) Antibody

20-abx171569
  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Recombinant Carboxypeptidase N2 (CPN2)

4-RPF324Hu01
  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P22792
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 36.3kDa
  • Isoelectric Point: 6.6
Description: Recombinant Human Carboxypeptidase N2 expressed in: E.coli

Rat Carboxypeptidase N2(CPN2)ELISA Kit

GA-E0867RT-48T 48T
EUR 317

Rat Carboxypeptidase N2(CPN2)ELISA Kit

GA-E0867RT-96T 96T
EUR 496

Rat Carboxypeptidase N2 (CPN2) ELISA Kit

20-abx155298
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Carboxypeptidase N2(CPN2)ELISA Kit

QY-E10016 96T
EUR 361

Rat Carboxypeptidase N2(CPN2)ELISA Kit

QY-E10785 96T
EUR 361

Mouse Carboxypeptidase N2(CPN2)ELISA Kit

QY-E20261 96T
EUR 361

Mouse Carboxypeptidase N2(CPN2)ELISA Kit

QY-E20262 96T
EUR 361

Rat Carboxypeptidase N2 (CPN2) ELISA Kit

SEF324Ra-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Carboxypeptidase N2 (CPN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Carboxypeptidase N2 (CPN2) in serum, plasma, tissue homogenates and other biological fluids.

Rat Carboxypeptidase N2 (CPN2) ELISA Kit

SEF324Ra-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Carboxypeptidase N2 (CPN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Carboxypeptidase N2 (CPN2) in serum, plasma, tissue homogenates and other biological fluids.

Rat Carboxypeptidase N2 (CPN2) ELISA Kit

SEF324Ra-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Carboxypeptidase N2 (CPN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Carboxypeptidase N2 (CPN2) in serum, plasma, tissue homogenates and other biological fluids.

Rat Carboxypeptidase N2 (CPN2) ELISA Kit

SEF324Ra-5x96wellstestplate 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Carboxypeptidase N2 (CPN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Carboxypeptidase N2 (CPN2) in serum, plasma, tissue homogenates and other biological fluids.

Rat Carboxypeptidase N2 (CPN2) ELISA Kit

4-SEF324Ra
  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Carboxypeptidase N2 elisa. Alternative names of the recognized antigen: ACBP
  • Carboxypeptidase N 83 kDa chain
  • Carboxypeptidase N large subunit
  • Carboxypeptidase N regulatory subunit
  • Carboxypeptidase N polypeptide 2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Carboxypeptidase N2 (CPN2) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Carboxypeptidase N2 (CPN2) Protein

20-abx168138
  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Carboxypeptidase N2 (CPN2) CLIA Kit

20-abx494865
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human CPN2 (Carboxypeptidase N2)

ELK5042 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Carboxypeptidase N2 (CPN2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Carboxy
  • Show more
Description: A sandwich ELISA kit for detection of Carboxypeptidase N2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Rat Carboxypeptidase N2 (CPN2) Protein

20-abx652777
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Rat Carboxypeptidase N2 (CPN2) CLIA Kit

20-abx494866
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Rat CPN2 (Carboxypeptidase N2)

ELK6729 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Carboxypeptidase N2 (CPN2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Carboxy
  • Show more
Description: A sandwich ELISA kit for detection of Carboxypeptidase N2 from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Carboxypeptidase N2 (CPN2) Polyclonal Antibody (Human)

4-PAF324Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CPN2 (Gln249~Ala540)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Carboxypeptidase N2 (CPN2)

Carboxypeptidase N2 (CPN2) Polyclonal Antibody (Human), APC

4-PAF324Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CPN2 (Gln249~Ala540)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Carboxypeptidase N2 (CPN2). This antibody is labeled with APC.

Carboxypeptidase N2 (CPN2) Polyclonal Antibody (Human), Biotinylated

4-PAF324Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CPN2 (Gln249~Ala540)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Carboxypeptidase N2 (CPN2). This antibody is labeled with Biotin.

Carboxypeptidase N2 (CPN2) Polyclonal Antibody (Human), Cy3

4-PAF324Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CPN2 (Gln249~Ala540)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Carboxypeptidase N2 (CPN2). This antibody is labeled with Cy3.

Carboxypeptidase N2 (CPN2) Polyclonal Antibody (Human), FITC

4-PAF324Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CPN2 (Gln249~Ala540)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Carboxypeptidase N2 (CPN2). This antibody is labeled with FITC.

Carboxypeptidase N2 (CPN2) Polyclonal Antibody (Human), HRP

4-PAF324Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CPN2 (Gln249~Ala540)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Carboxypeptidase N2 (CPN2). This antibody is labeled with HRP.

Carboxypeptidase N2 (CPN2) Polyclonal Antibody (Human), PE

4-PAF324Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CPN2 (Gln249~Ala540)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Carboxypeptidase N2 (CPN2). This antibody is labeled with PE.

Carboxypeptidase N2 (CPN2) Polyclonal Antibody (Human), APC-Cy7

4-PAF324Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CPN2 (Gln249~Ala540)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Carboxypeptidase N2 (CPN2). This antibody is labeled with APC-Cy7.

Carboxypeptidase N2 antibody

70R-49584 100 ul
EUR 244
Description: Purified Polyclonal Carboxypeptidase N2 antibody

Carboxypeptidase N2 antibody

70R-3276 50 ug
EUR 467
Description: Rabbit polyclonal Carboxypeptidase N2 antibody raised against the N terminal of CPN2

Carboxypeptidase N2 Blocking Peptide

33R-3103 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CPN2 antibody, catalog no. 70R-3276

Human Carboxypeptidase N Subunit 2 (CPN2) ELISA Kit

abx512707-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human CPN2/ Carboxypeptidase N subunit 2 ELISA Kit

E0548Hu 1 Kit
EUR 571

Human Carboxypeptidase N subunit 2(CPN2) ELISA kit

E01C2009-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Carboxypeptidase N subunit 2(CPN2) ELISA kit

E01C2009-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Carboxypeptidase N subunit 2(CPN2) ELISA kit

E01C2009-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Carboxypeptidase N subunit 2(CPN2) ELISA kit

CSB-EL005899HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Carboxypeptidase N subunit 2 (CPN2) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Carboxypeptidase N subunit 2(CPN2) ELISA kit

1-CSB-EL005899HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Carboxypeptidase N subunit 2(CPN2) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Carboxypeptidase N 2 (CPN2) Antibody

20-abx009403
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Mouse Carboxypeptidase N Subunit 2 (CPN2) ELISA Kit

abx512708-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Goat Carboxypeptidase N subunit 2(CPN2) ELISA kit

E06C2009-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Carboxypeptidase N subunit 2(CPN2) ELISA kit

E06C2009-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Carboxypeptidase N subunit 2(CPN2) ELISA kit

E06C2009-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Carboxypeptidase N subunit 2(CPN2) ELISA kit

E02C2009-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Carboxypeptidase N subunit 2(CPN2) ELISA kit

E02C2009-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Carboxypeptidase N subunit 2(CPN2) ELISA kit

E02C2009-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Carboxypeptidase N subunit 2(CPN2) ELISA kit

E03C2009-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Carboxypeptidase N subunit 2(CPN2) ELISA kit

E03C2009-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Carboxypeptidase N subunit 2(CPN2) ELISA kit

E03C2009-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Carboxypeptidase N subunit 2(CPN2) ELISA kit

E04C2009-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Carboxypeptidase N subunit 2(CPN2) ELISA kit

E04C2009-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Carboxypeptidase N subunit 2(CPN2) ELISA kit

E04C2009-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Carboxypeptidase N subunit 2(CPN2) ELISA kit

E07C2009-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Carboxypeptidase N subunit 2(CPN2) ELISA kit

E07C2009-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Carboxypeptidase N subunit 2(CPN2) ELISA kit

E07C2009-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Carboxypeptidase N subunit 2(CPN2) ELISA kit

E08C2009-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Carboxypeptidase N subunit 2(CPN2) ELISA kit

E08C2009-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Carboxypeptidase N subunit 2(CPN2) ELISA kit

E08C2009-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Carboxypeptidase N subunit 2(CPN2) ELISA kit

E09C2009-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Carboxypeptidase N subunit 2(CPN2) ELISA kit

E09C2009-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Carboxypeptidase N subunit 2(CPN2) ELISA kit

E09C2009-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Carboxypeptidase N subunit 2(CPN2) ELISA kit

E05C2009-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Carboxypeptidase N subunit 2(CPN2) ELISA kit

E05C2009-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Carboxypeptidase N subunit 2(CPN2) ELISA kit

E05C2009-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

CPN2 ELISA KIT|Human

EF007457 96 Tests
EUR 689

CPN2 ELISA Kit (Human) (OKCD00699)

OKCD00699 96 Wells
EUR 831
Description: Description of target: The 83 kDa subunit binds and stabilizes the catalytic subunit at 37 degrees Celsius and keeps it in circulation. Under some circumstances it may be an allosteric modifier of the catalytic subunit. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.63 ng/mL

CPN2 ELISA Kit (Human) (OKEH06913)

OKEH06913 96 Wells
EUR 662
Description: Description of target: The 83 kDa subunit binds and stabilizes the catalytic subunit at 37 degrees Celsius and keeps it in circulation. Under some circumstances it may be an allosteric modifier of the catalytic subunit. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.78U/L

N2,N2-Dimethylguanosine

HY-113137 5mg
EUR 187

CPN2 ELISA Kit (Rat) (OKCD08772)

OKCD08772 96 Wells
EUR 1053
Description: Description of target: ;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 0.61ng/mL

Human Protein Kinase N2(PKN2)ELISA Kit

QY-E03859 96T
EUR 361

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

CPN2 siRNA

20-abx912672
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CPN2 siRNA

20-abx912673
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CPN2 antibody

70R-37038 100 ug
EUR 327
Description: Rabbit Polyclonal CPN2 antibody

CPN2 Antibody

ABD3901 100 ug
EUR 438

CPN2 Antibody

34551-100ul 100ul
EUR 252

CPN2 Antibody

34551-50ul 50ul
EUR 187

CPN2 Antibody

DF3901 200ul
EUR 304
Description: CPN2 Antibody detects endogenous levels of total CPN2.

CPN2 Antibody

1-CSB-PA007245
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CPN2. Recognizes CPN2 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

CPN2 Antibody

CSB-PA276934-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against CPN2. Recognizes CPN2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

CPN2 Antibody

CSB-PA276934-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against CPN2. Recognizes CPN2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

N2-Methylguanosine

HY-111647 10mg
EUR 337

pEGFP- N2

PVT1203 2 ug
EUR 241

Bacopaside N2

TBW00873 5mg Ask for price

Human Carboxypeptidase B1 ELISA kit

E01C0730-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase B1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Carboxypeptidase B1 ELISA kit

E01C0730-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase B1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Carboxypeptidase B1 ELISA kit

E01C0730-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase B1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Carboxypeptidase A1 ELISA KIT|Human

EF008381 96 Tests
EUR 689

Carboxypeptidase A2 ELISA KIT|Human

EF008382 96 Tests
EUR 689

Carboxypeptidase A3 ELISA KIT|Human

EF008383 96 Tests
EUR 689

Carboxypeptidase A5 ELISA KIT|Human

EF008384 96 Tests
EUR 689

Carboxypeptidase A6 ELISA KIT|Human

EF008385 96 Tests
EUR 689

Human CPN2 shRNA Plasmid

20-abx950959
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CPN2 Recombinant Protein (Human)

RP038263 100 ug Ask for price

Human Forkhead box protein N2, FOXN2 ELISA KIT

ELI-27523h 96 Tests
EUR 824

CPN2 Conjugated Antibody

C34551 100ul
EUR 397

CPN2 cloning plasmid

CSB-CL005899HU-10ug 10ug
EUR 569
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1638
  • Sequence: ATGCTCCCTGGAGCCTGGCTGCTCTGGACCTCCCTCCTGCTCCTGGCCAGGCCTGCCCAGCCCTGTCCCATGGGTTGTGACTGCTTCGTCCAGGAGGTGTTCTGCTCAGATGAGGAGCTTGCCACCGTCCCGCTGGACATCCCGCCATATACGAAAAACATCATCTTTGTGGAGA
  • Show more
Description: A cloning plasmid for the CPN2 gene.

Anti-CPN2 Antibody

A05815 100ul
EUR 397
Description: Rabbit Polyclonal CPN2 Antibody. Validated in WB and tested in Human.

CPN2 Blocking Peptide

DF3901-BP 1mg
EUR 195

pCMV-SPORT6-CPN2

PVT14455 2 ug
EUR 495

Rat Protein Kinase N2(PKN2)ELISA Kit

QY-E10166 96T
EUR 361

Mouse Protein Kinase N2(PKN2)ELISA Kit

QY-E21278 96T
EUR 361

Human Carboxypeptidase A2 (CPA2) ELISA Kit

abx512714-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Carboxypeptidase B2 (CPB2) ELISA Kit

abx573782-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Human Carboxypeptidase M (CPM) ELISA Kit

abx576436-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human CPA2/ Carboxypeptidase A2 ELISA Kit

E0543Hu 1 Kit
EUR 571

Human CPB2/ Carboxypeptidase B2 ELISA Kit

E0545Hu 1 Kit
EUR 571

Human CPM/ Carboxypeptidase M ELISA Kit

E0547Hu 1 Kit
EUR 571

Human Probable carboxypeptidase (PM20D1) ELISA kit

E01P0720-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Probable carboxypeptidase (PM20D1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Probable carboxypeptidase (PM20D1) ELISA kit

E01P0720-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Probable carboxypeptidase (PM20D1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CPN2(Carboxypeptidase N2) ELISA Kit