Human CES1(Carboxylesterase 1) ELISA Kit

To Order: Contact

Human Carboxylesterase 1 (CES1) ELISA Kit

RDR-CES1-Hu-48Tests 48 Tests
EUR 544

Human Carboxylesterase 1 (CES1) ELISA Kit

RDR-CES1-Hu-96Tests 96 Tests
EUR 756

Mouse Carboxylesterase 1 (CES1) ELISA Kit

DLR-CES1-Mu-48T 48T
EUR 527
  • Should the Mouse Carboxylesterase 1 (CES1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Carboxylesterase 1 (CES1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Carboxylesterase 1 (CES1) ELISA Kit

DLR-CES1-Mu-96T 96T
EUR 688
  • Should the Mouse Carboxylesterase 1 (CES1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Carboxylesterase 1 (CES1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Carboxylesterase 1 (CES1) ELISA Kit

DLR-CES1-Ra-48T 48T
EUR 549
  • Should the Rat Carboxylesterase 1 (CES1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Carboxylesterase 1 (CES1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Carboxylesterase 1 (CES1) ELISA Kit

DLR-CES1-Ra-96T 96T
EUR 718
  • Should the Rat Carboxylesterase 1 (CES1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Carboxylesterase 1 (CES1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Carboxylesterase 1 (CES1) ELISA Kit

RDR-CES1-Mu-48Tests 48 Tests
EUR 557

Mouse Carboxylesterase 1 (CES1) ELISA Kit

RDR-CES1-Mu-96Tests 96 Tests
EUR 774

Rat Carboxylesterase 1 (CES1) ELISA Kit

RDR-CES1-Ra-48Tests 48 Tests
EUR 583

Rat Carboxylesterase 1 (CES1) ELISA Kit

RDR-CES1-Ra-96Tests 96 Tests
EUR 811

Rat Carboxylesterase 1 (CES1) ELISA Kit

RD-CES1-Ra-48Tests 48 Tests
EUR 557

Rat Carboxylesterase 1 (CES1) ELISA Kit

RD-CES1-Ra-96Tests 96 Tests
EUR 775

Anti-Liver Carboxylesterase 1/CES1 Antibody

A01741-1 100ug/vial
EUR 334

Human Carboxylesterase 1 (CES1)ELISA Kit

201-12-2396 96 tests
EUR 440
  • This Carboxylesterase 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Carboxylesterase 1 (CES1) ELISA Kit

20-abx156849
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Carboxylesterase 1(CES1)ELISA Kit

QY-E01350 96T
EUR 361

Human Carboxylesterase 1 (CES1) ELISA Kit

SEC374Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carboxylesterase 1 (CES1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carboxylesterase 1 (CES1) in serum, plasma, tissue homogenates and other biological fluids.

Human Carboxylesterase 1 (CES1) ELISA Kit

SEC374Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carboxylesterase 1 (CES1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carboxylesterase 1 (CES1) in serum, plasma, tissue homogenates and other biological fluids.

Human Carboxylesterase 1 (CES1) ELISA Kit

SEC374Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carboxylesterase 1 (CES1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carboxylesterase 1 (CES1) in serum, plasma, tissue homogenates and other biological fluids.

Human Carboxylesterase 1 (CES1) ELISA Kit

SEC374Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carboxylesterase 1 (CES1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carboxylesterase 1 (CES1) in serum, plasma, tissue homogenates and other biological fluids.

Human Carboxylesterase 1 (CES1) ELISA Kit

4-SEC374Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Carboxylesterase 1 elisa. Alternative names of the recognized antigen: ACAT
  • CEH
  • CES2
  • HMSE1
  • PCE1
  • SES1
  • TGH
  • Retinyl ester hydrolase
  • Serine esterase 1
  • Triacylglycerol hydrolase
  • Egasyn
  • Cocaine carboxylesterase
  • Liver Carboxylester
  • Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Carboxylesterase 1 (CES1) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Carboxylesterase 1 (CES1) ELISA Kit

20-abx155297
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Carboxylesterase 1 (CES1) ELISA Kit

abx576674-96tests 96 tests
EUR 864
  • Shipped within 5-12 working days.

Rat Carboxylesterase 1(CES1)ELISA Kit

GA-E0865RT-48T 48T
EUR 336

Rat Carboxylesterase 1(CES1)ELISA Kit

GA-E0865RT-96T 96T
EUR 534

Rat Carboxylesterase 1(CES1)ELISA Kit

QY-E10787 96T
EUR 361

Rat Carboxylesterase 1 (CES1) ELISA Kit

SEC374Ra-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Carboxylesterase 1 (CES1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Carboxylesterase 1 (CES1) in serum, plasma, tissue homogenates and other biological fluids.

Rat Carboxylesterase 1 (CES1) ELISA Kit

SEC374Ra-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Carboxylesterase 1 (CES1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Carboxylesterase 1 (CES1) in serum, plasma, tissue homogenates and other biological fluids.

Rat Carboxylesterase 1 (CES1) ELISA Kit

SEC374Ra-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Carboxylesterase 1 (CES1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Carboxylesterase 1 (CES1) in serum, plasma, tissue homogenates and other biological fluids.

Rat Carboxylesterase 1 (CES1) ELISA Kit

SEC374Ra-5x96wellstestplate 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Carboxylesterase 1 (CES1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Carboxylesterase 1 (CES1) in serum, plasma, tissue homogenates and other biological fluids.

Rat Carboxylesterase 1 (CES1) ELISA Kit

4-SEC374Ra
  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Carboxylesterase 1 elisa. Alternative names of the recognized antigen: ACAT
  • CEH
  • CES2
  • HMSE1
  • PCE1
  • SES1
  • TGH
  • Retinyl ester hydrolase
  • Serine esterase 1
  • Triacylglycerol hydrolase
  • Egasyn
  • Cocaine carboxylesterase
  • Liver Carboxylester
  • Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Carboxylesterase 1 (CES1) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Carboxylesterase 1(CES1)ELISA Kit

QY-E20255 96T
EUR 361

Active Carboxylesterase 1 (CES1)

4-APC374Hu01
  • EUR 664.48
  • EUR 281.00
  • EUR 2216.80
  • EUR 805.60
  • EUR 1511.20
  • EUR 508.00
  • EUR 5392.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P23141
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 34.0kDa
  • Isoelectric Point: 6.8
Description: Recombinant Human Carboxylesterase 1 expressed in: Gallus

Carboxylesterase 1 (CES1) Antibody

20-abx111385
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Carboxylesterase 1 (CES1) Antibody

20-abx130593
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Carboxylesterase 1 (CES1) Antibody

20-abx130594
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Carboxylesterase 1 (CES1) Antibody

20-abx130595
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Carboxylesterase 1 (CES1) Antibody

20-abx141637
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Carboxylesterase 1 (CES1) Antibody

20-abx171560
  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Carboxylesterase 1 (CES1) Antibody

20-abx318174
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Carboxylesterase 1 (CES1) Antibody

abx432495-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Carboxylesterase 1 (CES1) Antibody

abx231615-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Carboxylesterase 1 (CES1) Antibody

20-abx001532
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Recombinant Carboxylesterase 1 (CES1)

4-RPC374Hu01
  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P23141
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 34.0kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Carboxylesterase 1 expressed in: E.coli

Recombinant Carboxylesterase 1 (CES1)

4-RPC374Mu01
  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q8VCC2
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 31.5kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Carboxylesterase 1 expressed in: E.coli

Recombinant Carboxylesterase 1 (CES1)

4-RPC374Ra01
  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q63108
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 34.1kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Carboxylesterase 1 expressed in: E.coli

ELISA kit for Human CES1 (Carboxylesterase 1)

ELK5131 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Carboxylesterase 1 (CES1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Carboxyl
  • Show more
Description: A sandwich ELISA kit for detection of Carboxylesterase 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Liver carboxylesterase 1, CES1 ELISA KIT

ELI-48044h 96 Tests
EUR 824

Human Carboxylesterase 1 (CES1) CLIA Kit

20-abx493647
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Carboxylesterase 1 (CES1) Protein

20-abx168930
  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Liver carboxylesterase 1, Ces1 ELISA KIT

ELI-09262m 96 Tests
EUR 865

ELISA kit for Rat CES1 (Carboxylesterase 1)

ELK6493 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Carboxylesterase 1 (CES1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Carboxyl
  • Show more
Description: A sandwich ELISA kit for detection of Carboxylesterase 1 from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Rat Carboxylesterase 1 (CES1) CLIA Kit

20-abx493648
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Carboxylesterase 1 (CES1) Protein

20-abx168931
  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rat Carboxylesterase 1 (CES1) Protein

20-abx168932
  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Carboxylesterase 1 (CES1) Antibody (HRP)

20-abx303388
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Carboxylesterase 1 (CES1) Antibody (FITC)

20-abx303389
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Carboxylesterase 1 (CES1) Antibody (Biotin)

20-abx303390
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human Carboxylesterase 1 (CES1) Protein (Active)

20-abx655873
  • EUR 913.00
  • EUR 328.00
  • EUR 2973.00
  • EUR 1107.00
  • EUR 634.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Carboxylesterase 1 (CES1) Polyclonal Antibody (Human)

4-PAC374Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CES1 (Gly18~Leu299)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Carboxylesterase 1 (CES1)

Ces1 ELISA Kit| Mouse Liver carboxylesterase 1 ELISA Kit

EF014398 96 Tests
EUR 689

Polyclonal Carboxylesterase 1 / CES1 Antibody (Internal)

APG02362G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Carboxylesterase 1 / CES1 (Internal). This antibody is tested and proven to work in the following applications:

Carboxylesterase 1 (CES1) Polyclonal Antibody (Mouse)

4-PAC374Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CES1 (Gly31~Arg286)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Carboxylesterase 1 (CES1)

Carboxylesterase 1 (CES1) Polyclonal Antibody (Rat)

4-PAC374Ra01
  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CES1 (His19~Leu300)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Carboxylesterase 1 (CES1)

Carboxylesterase 1 (CES1) Polyclonal Antibody (Human), APC

4-PAC374Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CES1 (Gly18~Leu299)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Carboxylesterase 1 (CES1). This antibody is labeled with APC.

Carboxylesterase 1 (CES1) Polyclonal Antibody (Human), Biotinylated

4-PAC374Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CES1 (Gly18~Leu299)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Carboxylesterase 1 (CES1). This antibody is labeled with Biotin.

Carboxylesterase 1 (CES1) Polyclonal Antibody (Human), Cy3

4-PAC374Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CES1 (Gly18~Leu299)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Carboxylesterase 1 (CES1). This antibody is labeled with Cy3.

Carboxylesterase 1 (CES1) Polyclonal Antibody (Human), FITC

4-PAC374Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CES1 (Gly18~Leu299)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Carboxylesterase 1 (CES1). This antibody is labeled with FITC.

Carboxylesterase 1 (CES1) Polyclonal Antibody (Human), HRP

4-PAC374Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CES1 (Gly18~Leu299)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Carboxylesterase 1 (CES1). This antibody is labeled with HRP.

Carboxylesterase 1 (CES1) Polyclonal Antibody (Human), PE

4-PAC374Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CES1 (Gly18~Leu299)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Carboxylesterase 1 (CES1). This antibody is labeled with PE.

Carboxylesterase 1 (CES1) Polyclonal Antibody (Human), APC-Cy7

4-PAC374Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CES1 (Gly18~Leu299)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Carboxylesterase 1 (CES1). This antibody is labeled with APC-Cy7.

Carboxylesterase 1 (CES1) Polyclonal Antibody (Mouse), APC

4-PAC374Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CES1 (Gly31~Arg286)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Carboxylesterase 1 (CES1). This antibody is labeled with APC.

Carboxylesterase 1 (CES1) Polyclonal Antibody (Mouse), Biotinylated

4-PAC374Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CES1 (Gly31~Arg286)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Carboxylesterase 1 (CES1). This antibody is labeled with Biotin.

Carboxylesterase 1 (CES1) Polyclonal Antibody (Mouse), Cy3

4-PAC374Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CES1 (Gly31~Arg286)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Carboxylesterase 1 (CES1). This antibody is labeled with Cy3.

Carboxylesterase 1 (CES1) Polyclonal Antibody (Mouse), FITC

4-PAC374Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CES1 (Gly31~Arg286)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Carboxylesterase 1 (CES1). This antibody is labeled with FITC.

Carboxylesterase 1 (CES1) Polyclonal Antibody (Mouse), HRP

4-PAC374Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CES1 (Gly31~Arg286)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Carboxylesterase 1 (CES1). This antibody is labeled with HRP.

Carboxylesterase 1 (CES1) Polyclonal Antibody (Mouse), PE

4-PAC374Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CES1 (Gly31~Arg286)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Carboxylesterase 1 (CES1). This antibody is labeled with PE.

Carboxylesterase 1 (CES1) Polyclonal Antibody (Rat), APC

4-PAC374Ra01-APC
  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CES1 (His19~Leu300)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Carboxylesterase 1 (CES1). This antibody is labeled with APC.

Carboxylesterase 1 (CES1) Polyclonal Antibody (Rat), Biotinylated

4-PAC374Ra01-Biotin
  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CES1 (His19~Leu300)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Carboxylesterase 1 (CES1). This antibody is labeled with Biotin.

Carboxylesterase 1 (CES1) Polyclonal Antibody (Rat), Cy3

4-PAC374Ra01-Cy3
  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CES1 (His19~Leu300)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Carboxylesterase 1 (CES1). This antibody is labeled with Cy3.

Carboxylesterase 1 (CES1) Polyclonal Antibody (Rat), FITC

4-PAC374Ra01-FITC
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CES1 (His19~Leu300)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Carboxylesterase 1 (CES1). This antibody is labeled with FITC.

Carboxylesterase 1 (CES1) Polyclonal Antibody (Rat), HRP

4-PAC374Ra01-HRP
  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CES1 (His19~Leu300)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Carboxylesterase 1 (CES1). This antibody is labeled with HRP.

Carboxylesterase 1 (CES1) Polyclonal Antibody (Rat), PE

4-PAC374Ra01-PE
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CES1 (His19~Leu300)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Carboxylesterase 1 (CES1). This antibody is labeled with PE.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Carboxylesterase 1 (CES1) Polyclonal Antibody (Mouse), APC-Cy7

4-PAC374Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CES1 (Gly31~Arg286)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Carboxylesterase 1 (CES1). This antibody is labeled with APC-Cy7.

Carboxylesterase 1 (CES1) Polyclonal Antibody (Rat), APC-Cy7

4-PAC374Ra01-APC-Cy7
  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CES1 (His19~Leu300)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Carboxylesterase 1 (CES1). This antibody is labeled with APC-Cy7.

Ces1/ Rat Ces1 ELISA Kit

ELI-26913r 96 Tests
EUR 886

Human Carboxylesterase 1 ELISA kit

E01C0060-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Carboxylesterase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Carboxylesterase 1 ELISA kit

E01C0060-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Carboxylesterase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Carboxylesterase 1 ELISA kit

E01C0060-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Carboxylesterase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

CES1 ELISA KIT|Human

EF008614 96 Tests
EUR 689

Mouse Carboxylesterase 1 ELISA kit

E03C0060-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Carboxylesterase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Carboxylesterase 1 ELISA kit

E03C0060-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Carboxylesterase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Carboxylesterase 1 ELISA kit

E03C0060-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Carboxylesterase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Carboxylesterase 1 ELISA kit

E06C0060-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Carboxylesterase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Carboxylesterase 1 ELISA kit

E06C0060-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Carboxylesterase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Carboxylesterase 1 ELISA kit

E06C0060-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Carboxylesterase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Carboxylesterase 1 ELISA kit

E04C0060-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Carboxylesterase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Carboxylesterase 1 ELISA kit

E04C0060-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Carboxylesterase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Carboxylesterase 1 ELISA kit

E04C0060-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Carboxylesterase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Carboxylesterase 1 ELISA kit

E02C0060-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Carboxylesterase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Carboxylesterase 1 ELISA kit

E02C0060-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Carboxylesterase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Carboxylesterase 1 ELISA kit

E02C0060-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Carboxylesterase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Carboxylesterase 1 ELISA kit

E09C0060-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Carboxylesterase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Carboxylesterase 1 ELISA kit

E09C0060-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Carboxylesterase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Carboxylesterase 1 ELISA kit

E09C0060-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Carboxylesterase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Carboxylesterase 1 ELISA kit

E08C0060-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Carboxylesterase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Carboxylesterase 1 ELISA kit

E08C0060-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Carboxylesterase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Carboxylesterase 1 ELISA kit

E08C0060-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Carboxylesterase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Carboxylesterase 1 ELISA kit

E07C0060-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Carboxylesterase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Carboxylesterase 1 ELISA kit

E07C0060-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Carboxylesterase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Carboxylesterase 1 ELISA kit

E07C0060-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Carboxylesterase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CES1 PicoKine ELISA Kit

EK1813 96 wells
EUR 425
Description: For quantitative detection of human CES1 in cell culture supernates, serum and plasma (heparin, EDTA).

CES1 ELISA Kit (Human) (OKCD01667)

OKCD01667 96 Wells
EUR 831
Description: Description of target: Involved in the detoxification of xenobiotics and in the activation of ester and amide prodrugs. Hydrolyzes aromatic and aliphatic esters, but has no catalytic activity toward amides or a fatty acyl-CoA ester. Hydrolyzes the methyl ester group of cocaine to form benzoylecgonine. Catalyzes the transesterification of cocaine to form cocaethylene. Displays fatty acid ethyl ester synthase activity, catalyzing the ethyl esterification of oleic acid to ethyloleate.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.057 ng/mL

CES1 ELISA Kit (Human) (OKBB01240)

OKBB01240 96 Wells
EUR 505
Description: Description of target: Liver carboxylesterase 1 also known as carboxylesterase 1 (CES1, hCE-1 or CES1A1) is an enzyme that in humans is encoded by the CES1 gene. This gene is mapped to 16q12.2. It encodes a member of the carboxylesterase large family. The family members are responsible for the hydrolysis or transesterification of various xenobiotics, such as cocaine and heroin, and endogenous substrates with ester, thioester, or amide bonds. They may participate in fatty acyl and cholesterol ester metabolism, and may play a role in the blood-brain barrier system. This enzyme is the major liver enzyme and functions in liver drug clearance. Mutations of this gene cause carboxylesterase 1 deficiency. Three transcript variants encoding three different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <0.1ng/ml

Guinea pig Carboxylesterase 1 ELISA kit

E05C0060-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Carboxylesterase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Carboxylesterase 1 ELISA kit

E05C0060-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Carboxylesterase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Carboxylesterase 1 ELISA kit

E05C0060-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Carboxylesterase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Ces1 ELISA Kit (Rat) (OKEH08795)

OKEH08795 96 Wells
EUR 896
Description: Description of target: ;Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 10pg/mL

Carboxylesterase 1 antibody

70R-1213 100 ug
EUR 377
Description: Rabbit polyclonal Carboxylesterase 1 antibody

Carboxylesterase 1 antibody

70R-1223 100 ug
EUR 377
Description: Rabbit polyclonal Carboxylesterase 1 antibody

Human CES5A/ Carboxylesterase 5A ELISA Kit

E0476Hu 1 Kit
EUR 605

Human Carboxylesterase 3(CES3) ELISA kit

E01C1625-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Carboxylesterase 3(CES3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Carboxylesterase 3(CES3) ELISA kit

E01C1625-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Carboxylesterase 3(CES3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Carboxylesterase 3(CES3) ELISA kit

E01C1625-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Carboxylesterase 3(CES3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Carboxylesterase 2 (CES2) ELISA Kit

20-abx156913
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Carboxylesterase 2 (CES2) ELISA Kit

20-abx258756
  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Carboxylesterase 5A (CES5A) ELISA Kit

abx251720-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Human CES5A(Carboxylesterase 5A) ELISA Kit

EH2362 96T
EUR 567.6
  • Detection range: 78-5000 pg/ml
  • Uniprot ID: Q6NT32
  • Alias: CES5A/CES7/Cauxin/Carboxylesterase-like urinary excreted protein homolog
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml

ELISA kit for Human Carboxylesterase 5A

EK4756 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Carboxylesterase 5A in samples from serum, plasma, tissue homogenates and other biological fluids.

Human Carboxylesterase 5A, CES5A ELISA KIT

ELI-26914h 96 Tests
EUR 824

Human Carboxylesterase 3, CES3 ELISA KIT

ELI-27351h 96 Tests
EUR 824

Human Carboxylesterase 4A, CES4A ELISA KIT

ELI-27352h 96 Tests
EUR 824

Human Carboxylesterase 3 (CES3) ELISA Kit

abx386480-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Carboxylesterase 2 ELISA Kit (CES2)

RK01089 96 Tests
EUR 521

Human Carboxylesterase 2 (CES2) ELISA Kit

SEF282Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carboxylesterase 2 (CES2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carboxylesterase 2 (CES2) in serum, plasma, tissue homogenates and other biological fluids.

Human Carboxylesterase 2 (CES2) ELISA Kit

SEF282Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carboxylesterase 2 (CES2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carboxylesterase 2 (CES2) in serum, plasma, tissue homogenates and other biological fluids.

Human Carboxylesterase 2 (CES2) ELISA Kit

SEF282Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carboxylesterase 2 (CES2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carboxylesterase 2 (CES2) in serum, plasma, tissue homogenates and other biological fluids.

Human Carboxylesterase 2 (CES2) ELISA Kit

SEF282Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carboxylesterase 2 (CES2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carboxylesterase 2 (CES2) in serum, plasma, tissue homogenates and other biological fluids.

Human Carboxylesterase 2 (CES2) ELISA Kit

4-SEF282Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Carboxylesterase 2 elisa. Alternative names of the recognized antigen: CE-2
  • CES2A1
  • PCE-2
  • iCE
  • Intestine, Liver
  • Methylumbelliferyl-acetate deacetylase 2
  • Cocaine esterase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Carboxylesterase 2 (CES2) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

CES1 antibody

70R-16360 50 ul
EUR 435
Description: Rabbit polyclonal CES1 antibody

CES1 Antibody

32472-100ul 100ul
EUR 252

CES1 Antibody

1-CSB-PA005258GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against CES1. Recognizes CES1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

CES1 Antibody

1-CSB-PA005258LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CES1. Recognizes CES1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

CES1 Antibody

DF6661 200ul
EUR 304
Description: CES1 Antibody detects endogenous levels of total CES1.

CES1 siRNA

20-abx911562
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CES1 siRNA

20-abx911563
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CES1 Antibody

ABD6661 100 ug
EUR 438

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

ELISA kit for Human CES2 (Carboxylesterase 2)

ELK5225 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Carboxylesterase 2 (CES2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Carboxyl
  • Show more
Description: A sandwich ELISA kit for detection of Carboxylesterase 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Carboxylesterase 2 (CES2)

KTE62570-48T 48T
EUR 354
  • Carboxylesterase 2 is a member of a large multigene family. The enzymes encoded by these genes are responsible for the hydrolysis of ester- and amide-bond-containing drugs such as cocaine and heroin. They also hydrolyze long-chain fatty acid esters a
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Carboxylesterase 2 (CES2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Carboxylesterase 2 (CES2)

KTE62570-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Carboxylesterase 2 is a member of a large multigene family. The enzymes encoded by these genes are responsible for the hydrolysis of ester- and amide-bond-containing drugs such as cocaine and heroin. They also hydrolyze long-chain fatty acid esters a
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Carboxylesterase 2 (CES2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Carboxylesterase 2 (CES2)

KTE62570-96T 96T
EUR 572
  • Carboxylesterase 2 is a member of a large multigene family. The enzymes encoded by these genes are responsible for the hydrolysis of ester- and amide-bond-containing drugs such as cocaine and heroin. They also hydrolyze long-chain fatty acid esters a
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Carboxylesterase 2 (CES2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Carboxylesterase 1 Blocking Peptide

33R-1397 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CES1 antibody, catalog no. 70R-1223

Carboxylesterase 1 Blocking Peptide

33R-9660 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CES1 antibody, catalog no. 70R-1213

anti-Liver Carboxylesterase 1

YF-PA10902 50 ug
EUR 363
Description: Mouse polyclonal to Liver Carboxylesterase 1

anti-Liver Carboxylesterase 1

YF-PA10903 100 ug
EUR 403
Description: Rabbit polyclonal to Liver Carboxylesterase 1

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Human CES1 shRNA Plasmid

20-abx950768
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CES1 Recombinant Protein (Human)

RP006835 100 ug Ask for price

Rat Carboxylesterase 3(CES3) ELISA kit

E02C1625-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Carboxylesterase 3(CES3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Carboxylesterase 3(CES3) ELISA kit

E02C1625-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Carboxylesterase 3(CES3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Carboxylesterase 3(CES3) ELISA kit

E02C1625-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Carboxylesterase 3(CES3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Carboxylesterase 3(CES3) ELISA kit

E03C1625-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Carboxylesterase 3(CES3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Carboxylesterase 3(CES3) ELISA kit

E03C1625-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Carboxylesterase 3(CES3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Carboxylesterase 3(CES3) ELISA kit

E03C1625-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Carboxylesterase 3(CES3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Carboxylesterase 3(CES3) ELISA kit

E06C1625-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Carboxylesterase 3(CES3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Carboxylesterase 3(CES3) ELISA kit

E06C1625-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Carboxylesterase 3(CES3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Carboxylesterase 3(CES3) ELISA kit

E06C1625-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Carboxylesterase 3(CES3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Carboxylesterase 3(CES3) ELISA kit

E04C1625-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Carboxylesterase 3(CES3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Carboxylesterase 3(CES3) ELISA kit

E04C1625-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Carboxylesterase 3(CES3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Carboxylesterase 3(CES3) ELISA kit

E04C1625-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Carboxylesterase 3(CES3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Carboxylesterase 3(CES3) ELISA kit

E07C1625-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Carboxylesterase 3(CES3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Carboxylesterase 3(CES3) ELISA kit

E07C1625-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Carboxylesterase 3(CES3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Carboxylesterase 3(CES3) ELISA kit

E07C1625-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Carboxylesterase 3(CES3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Carboxylesterase 5A (CES5A) ELISA Kit

abx255136-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Rat Carboxylesterase 5A (CES5A) ELISA Kit

abx256649-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Monkey Carboxylesterase 3(CES3) ELISA kit

E09C1625-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Carboxylesterase 3(CES3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Carboxylesterase 3(CES3) ELISA kit

E09C1625-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Carboxylesterase 3(CES3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Carboxylesterase 3(CES3) ELISA kit

E09C1625-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Carboxylesterase 3(CES3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Rat Carboxylesterase 5A

EK4754 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Rat Carboxylesterase 5A in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Mouse Carboxylesterase 5A

EK4755 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Carboxylesterase 5A in samples from serum, plasma, tissue homogenates and other biological fluids.

Dog Carboxylesterase 3(CES3) ELISA kit

E08C1625-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Carboxylesterase 3(CES3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Carboxylesterase 3(CES3) ELISA kit

E08C1625-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Carboxylesterase 3(CES3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Carboxylesterase 3(CES3) ELISA kit

E08C1625-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Carboxylesterase 3(CES3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Ces5a/ Carboxylesterase 5A ELISA Kit

E1058Ra 1 Kit
EUR 646

Mouse Ces5a/ Carboxylesterase 5A ELISA Kit

E1624Mo 1 Kit
EUR 632

Bovine Carboxylesterase 4A, CES4A ELISA KIT

ELI-09958b 96 Tests
EUR 928

Mouse Carboxylesterase 3, Ces3 ELISA KIT

ELI-25503m 96 Tests
EUR 865

Mouse Carboxylesterase 5A, Ces5a ELISA KIT

ELI-26955m 96 Tests
EUR 865

Mouse Carboxylesterase 4A, Ces4a ELISA KIT

ELI-08324m 96 Tests
EUR 865

Dog Carboxylesterase 5A (CES5A) ELISA Kit

abx520651-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Ces5a( Carboxylesterase 5A) ELISA Kit

EM0788 96T
EUR 567.6
  • Detection range: 0.312-20 ng/ml
  • Uniprot ID: Q6AW46
  • Alias: Ces5a/CES5A/CES7/Cauxin/Carboxylesterase-like urinary excreted protein homolog
Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: Mus ;Sensitivity: 0.188 ng/ml

Rat Ces5a(Carboxylesterase 5A) ELISA Kit

ER0674 96T
EUR 567.6
  • Detection range: 0.312-20 ng/ml
  • Uniprot ID: Q5GRG2
  • Alias: Ces5a/Carboxylesterase-like urinary excreted protein homolog(Cauxin)/Epididymis-specific gene 615 protein/
Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: Rattus;Sensitivity: 0.188 ng/ml

CES1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0436002 1.0 ug DNA
EUR 154

Ces5a ELISA Kit| Rat Carboxylesterase 5A ELISA Kit

EF017489 96 Tests
EUR 689

Ces5a ELISA Kit| Mouse Carboxylesterase 5A ELISA Kit

EF013398 96 Tests
EUR 689

Human NOTUM/ Palmitoleoyl-protein carboxylesterase NOTUM ELISA Kit

E1769Hu 1 Kit
EUR 571

Human Putative inactive carboxylesterase 4, CES1P1 ELISA KIT

ELI-33682h 96 Tests
EUR 824

Wide-range Human Carboxylesterase 2 (CES2) ELISA Kit

WEF282Hu-10x96wellstestplate 10x96-wells test plate
EUR 4502.43
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Wide-range Human Carboxylesterase 2 (CES2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Wide-range Human Carboxylesterase 2 (CES2) in serum, plasma, tissue homogenates and other biological fluids.

Wide-range Human Carboxylesterase 2 (CES2) ELISA Kit

WEF282Hu-1x48wellstestplate 1x48-wells test plate
EUR 458.44
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Wide-range Human Carboxylesterase 2 (CES2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Wide-range Human Carboxylesterase 2 (CES2) in serum, plasma, tissue homogenates and other biological fluids.

Wide-range Human Carboxylesterase 2 (CES2) ELISA Kit

WEF282Hu-1x96wellstestplate 1x96-wells test plate
EUR 612.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Wide-range Human Carboxylesterase 2 (CES2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Wide-range Human Carboxylesterase 2 (CES2) in serum, plasma, tissue homogenates and other biological fluids.

Wide-range Human Carboxylesterase 2 (CES2) ELISA Kit

WEF282Hu-5x96wellstestplate 5x96-wells test plate
EUR 2454.23
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Wide-range Human Carboxylesterase 2 (CES2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Wide-range Human Carboxylesterase 2 (CES2) in serum, plasma, tissue homogenates and other biological fluids.

Wide-range Human Carboxylesterase 2 (CES2) ELISA Kit

4-WEF282Hu
  • EUR 4553.00
  • EUR 2405.00
  • EUR 613.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Carboxylesterase 2 elisa. Alternative names of the recognized antigen: CE-2
  • CES2A1
  • PCE-2
  • iCE
  • Intestine, Liver
  • Methylumbelliferyl-acetate deacetylase 2
  • Cocaine esterase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Wide-range Human Carboxylesterase 2 (CES2) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

CES1 Blocking Peptide

DF6661-BP 1mg
EUR 195

CES1 Conjugated Antibody

C32472 100ul
EUR 397

CES1 cloning plasmid

CSB-CL005258HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1701
  • Sequence: atgtggctccctgctcttgtcctggccactctcgctgcttccgcggcttgggggcatccgtcctcgccacctgtggtggacaccgtgcatggcaaagtgctggggaagttcgtcagcttagaaggatttgcacagcctgtggccattttcctgggaatcccttttgccaagccgc
  • Show more
Description: A cloning plasmid for the CES1 gene.

CES1 Polyclonal Antibody

A62258 100 µg
EUR 570.55
Description: reagents widely cited

CES1 Rabbit pAb

A1853-100ul 100 ul
EUR 308

CES1 Rabbit pAb

A1853-200ul 200 ul
EUR 459

CES1 Rabbit pAb

A1853-20ul 20 ul
EUR 183

Human CES1(Carboxylesterase 1) ELISA Kit