Human ASAH2(N-Acylsphingosine Amidohydrolase 2) ELISA Kit

To Order: Contact

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody

abx025039-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody

20-abx173712
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody

20-abx177710
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody

20-abx214010
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody

20-abx214011
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody

20-abx303129
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) ELISA Kit

20-abx156834
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human N-Acylsphingosine Amidohydrolase 2(ASAH2)ELISA Kit

QY-E04735 96T
EUR 361

Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) ELISA Kit

SEE689Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) in serum, plasma, tissue homogenates and other biological fluids.

Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) ELISA Kit

SEE689Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) in serum, plasma, tissue homogenates and other biological fluids.

Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) ELISA Kit

SEE689Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) in serum, plasma, tissue homogenates and other biological fluids.

Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) ELISA Kit

SEE689Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) in serum, plasma, tissue homogenates and other biological fluids.

Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) ELISA Kit

4-SEE689Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as N-Acylsphingosine Amidohydrolase 2 elisa. Alternative names of the recognized antigen: HNAC1
  • non-lysosomal ceramidase
  • Neutral ceramidase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) Protein

20-abx654471
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) CLIA Kit

20-abx494694
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human ASAH2 (N-Acylsphingosine Amidohydrolase 2)

ELK5107 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to N-Acylsphingosine Amidohydrolase 2 (ASAH2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody spe
  • Show more
Description: A sandwich ELISA kit for detection of N-Acylsphingosine Amidohydrolase 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody (HRP)

20-abx303130
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody (FITC)

20-abx303131
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody (Biotin)

20-abx303132
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human N-Acylsphingosine Amidohydrolase 1 (ASAH1) ELISA Kit

20-abx150748
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human N-Acylsphingosine Amidohydrolase 1 (ASAH1) ELISA Kit

DLR-ASAH1-Hu-48T 48T
EUR 517
  • Should the Human N-Acylsphingosine Amidohydrolase 1 (ASAH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human N-Acylsphingosine Amidohydrolase 1 (ASAH1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human N-Acylsphingosine Amidohydrolase 1 (ASAH1) ELISA Kit

DLR-ASAH1-Hu-96T 96T
EUR 673
  • Should the Human N-Acylsphingosine Amidohydrolase 1 (ASAH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human N-Acylsphingosine Amidohydrolase 1 (ASAH1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human N-Acylsphingosine Amidohydrolase 1 (ASAH1) ELISA Kit

SEC302Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human N-Acylsphingosine Amidohydrolase 1 (ASAH1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human N-Acylsphingosine Amidohydrolase 1 (ASAH1) in tissue homogenates, cell lysates and other biological fluids.

Human N-Acylsphingosine Amidohydrolase 1 (ASAH1) ELISA Kit

SEC302Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human N-Acylsphingosine Amidohydrolase 1 (ASAH1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human N-Acylsphingosine Amidohydrolase 1 (ASAH1) in tissue homogenates, cell lysates and other biological fluids.

Human N-Acylsphingosine Amidohydrolase 1 (ASAH1) ELISA Kit

SEC302Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human N-Acylsphingosine Amidohydrolase 1 (ASAH1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human N-Acylsphingosine Amidohydrolase 1 (ASAH1) in tissue homogenates, cell lysates and other biological fluids.

Human N-Acylsphingosine Amidohydrolase 1 (ASAH1) ELISA Kit

SEC302Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human N-Acylsphingosine Amidohydrolase 1 (ASAH1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human N-Acylsphingosine Amidohydrolase 1 (ASAH1) in tissue homogenates, cell lysates and other biological fluids.

Human N-Acylsphingosine Amidohydrolase 1 (ASAH1) ELISA Kit

4-SEC302Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as N-Acylsphingosine Amidohydrolase 1 elisa. Alternative names of the recognized antigen: AC
  • ASAH
  • PHP
  • PHP32
  • Acid Ceramidase
  • Acylsphingosine deacylase
  • Putative 32 kDa heart protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human N-Acylsphingosine Amidohydrolase 1 (ASAH1) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human N-Acylsphingosine Amidohydrolase 1 ELISA Kit (ASAH1)

RK00948 96 Tests
EUR 521

Human N-Acylsphingosine Amidohydrolase 1 (ASAH1) ELISA Kit

RD-ASAH1-Hu-48Tests 48 Tests
EUR 521

Human N-Acylsphingosine Amidohydrolase 1 (ASAH1) ELISA Kit

RD-ASAH1-Hu-96Tests 96 Tests
EUR 723

Human N-Acylsphingosine Amidohydrolase 1 (ASAH1) ELISA Kit

RDR-ASAH1-Hu-48Tests 48 Tests
EUR 544

Human N-Acylsphingosine Amidohydrolase 1 (ASAH1) ELISA Kit

RDR-ASAH1-Hu-96Tests 96 Tests
EUR 756

N-Acylsphingosine Amidohydrolase 1 (ASAH1) Antibody

20-abx113985
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

N-Acylsphingosine Amidohydrolase 1 (ASAH1) Antibody

20-abx128162
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

N-Acylsphingosine Amidohydrolase 1 (ASAH1) Antibody

20-abx005006
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

N-Acylsphingosine Amidohydrolase 1 (ASAH1) Antibody

20-abx173711
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

N-Acylsphingosine Amidohydrolase 1 (ASAH1) Antibody

20-abx320092
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

N-Acylsphingosine Amidohydrolase 1 (ASAH1) Antibody

20-abx322330
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

N-Acylsphingosine Amidohydrolase 1 (ASAH1) Antibody

20-abx214784
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

N-Acylsphingosine Amidohydrolase 1 (ASAH1) Antibody

20-abx241022
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

N-Acylsphingosine Amidohydrolase 1 (ASAH1) Antibody

20-abx301890
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

N-Acylsphingosine Amidohydrolase 1 (ASAH1) Antibody

abx230618-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Recombinant N-Acylsphingosine Amidohydrolase 1 (ASAH1)

4-RPC302Hu01
  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q13510
  • Buffer composition: 100mMNaHCO3, 500mMNaCl, pH8.3, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 32.7kDa
  • Isoelectric Point: 7.5
Description: Recombinant Human N-Acylsphingosine Amidohydrolase 1 expressed in: E.coli

ELISA kit for Human ASAH1 (N-Acylsphingosine Amidohydrolase 1)

ELK2966 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to N-Acylsphingosine Amidohydrolase 1 (ASAH1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody spe
  • Show more
Description: A sandwich ELISA kit for detection of N-Acylsphingosine Amidohydrolase 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human N-Acylsphingosine Amidohydrolase 1 (ASAH1) CLIA Kit

20-abx493599
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human N-Acylsphingosine Amidohydrolase 1 (ASAH1) Protein

20-abx166591
  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

N-Acylsphingosine Amidohydrolase 1 (ASAH1) Antibody (HRP)

20-abx317374
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

N-Acylsphingosine Amidohydrolase 1 (ASAH1) Antibody (FITC)

20-abx317375
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

N-Acylsphingosine Amidohydrolase 1 (ASAH1) Antibody (Biotin)

20-abx317376
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

N-Acylsphingosine Amidohydrolase 1 (ASAH1) Polyclonal Antibody (Human, Mouse)

4-PAC302Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ASAH1 (Cys143~Trp395)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse N-Acylsphingosine Amidohydrolase 1 (ASAH1)

N-Acylsphingosine Amidohydrolase 1 (ASAH1) Polyclonal Antibody (Human, Mouse), APC

4-PAC302Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ASAH1 (Cys143~Trp395)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse N-Acylsphingosine Amidohydrolase 1 (ASAH1). This antibody is labeled with APC.

N-Acylsphingosine Amidohydrolase 1 (ASAH1) Polyclonal Antibody (Human, Mouse), Biotinylated

4-PAC302Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ASAH1 (Cys143~Trp395)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse N-Acylsphingosine Amidohydrolase 1 (ASAH1). This antibody is labeled with Biotin.

N-Acylsphingosine Amidohydrolase 1 (ASAH1) Polyclonal Antibody (Human, Mouse), Cy3

4-PAC302Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ASAH1 (Cys143~Trp395)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse N-Acylsphingosine Amidohydrolase 1 (ASAH1). This antibody is labeled with Cy3.

N-Acylsphingosine Amidohydrolase 1 (ASAH1) Polyclonal Antibody (Human, Mouse), FITC

4-PAC302Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ASAH1 (Cys143~Trp395)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse N-Acylsphingosine Amidohydrolase 1 (ASAH1). This antibody is labeled with FITC.

N-Acylsphingosine Amidohydrolase 1 (ASAH1) Polyclonal Antibody (Human, Mouse), HRP

4-PAC302Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ASAH1 (Cys143~Trp395)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse N-Acylsphingosine Amidohydrolase 1 (ASAH1). This antibody is labeled with HRP.

N-Acylsphingosine Amidohydrolase 1 (ASAH1) Polyclonal Antibody (Human, Mouse), PE

4-PAC302Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ASAH1 (Cys143~Trp395)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse N-Acylsphingosine Amidohydrolase 1 (ASAH1). This antibody is labeled with PE.

N-Acylsphingosine Amidohydrolase 1 (ASAH1) Polyclonal Antibody (Human, Mouse), APC-Cy7

4-PAC302Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ASAH1 (Cys143~Trp395)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse N-Acylsphingosine Amidohydrolase 1 (ASAH1). This antibody is labeled with APC-Cy7.

ASAH2 ELISA Kit (Human) (OKCD01831)

OKCD01831 96 Wells
EUR 831
Description: Description of target: Hydrolyzes the sphingolipid ceramide into sphingosine and free fatty acid at an optimal pH of 6.5-8.5. Acts as a key regulator of sphingolipid signaling metabolites by generating sphingosine at the cell surface. Acts as a repressor of apoptosis both by reducing C16-ceramide, thereby preventing ceramide-induced apoptosis, and generating sphingosine, a precursor of the antiapoptotic factor sphingosine 1-phosphate. Probably involved in the digestion of dietary sphingolipids in intestine by acting as a key enzyme for the catabolism of dietary sphingolipids and regulating the levels of bioactive sphingolipid metabolites in the intestinal tract.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.31 ng/mL

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Human Protein N-terminal asparagine amidohydrolase (NTAN1) ELISA Kit

abx555958-96tests 96 tests
EUR 668
  • Shipped within 1-3 weeks.

Human Protein N terminal asparagine amidohydrolase(NTAN1) ELISA kit

E01P0818-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Protein N terminal asparagine amidohydrolase(NTAN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Protein N terminal asparagine amidohydrolase(NTAN1) ELISA kit

E01P0818-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Protein N terminal asparagine amidohydrolase(NTAN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Protein N terminal asparagine amidohydrolase(NTAN1) ELISA kit

E01P0818-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Protein N terminal asparagine amidohydrolase(NTAN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human Protein N-terminal asparagine amidohydrolase

EK3211 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Protein N-terminal asparagine amidohydrolase in samples from serum, plasma, tissue homogenates and other biological fluids.

Human NTAN1/ Protein N-terminal asparagine amidohydrolase ELISA Kit

E1801Hu 1 Kit
EUR 605

Human Protein N-terminal glutamine amidohydrolase (WDYHV1) ELISA Kit

abx385518-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Protein N- terminal asparagine amidohydrolase, NTAN1 ELISA

ELI-44216h 96 Tests
EUR 824

Pig Protein N-terminal asparagine amidohydrolase (NTAN1) ELISA Kit

abx555663-96tests 96 tests
EUR 911
  • Shipped within 1-3 weeks.

Mouse Protein N-terminal asparagine amidohydrolase (NTAN1) ELISA Kit

abx556057-96tests 96 tests
EUR 668
  • Shipped within 1-3 weeks.

Rat Protein N terminal asparagine amidohydrolase(NTAN1) ELISA kit

E02P0818-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Protein N terminal asparagine amidohydrolase(NTAN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Protein N terminal asparagine amidohydrolase(NTAN1) ELISA kit

E02P0818-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Protein N terminal asparagine amidohydrolase(NTAN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Protein N terminal asparagine amidohydrolase(NTAN1) ELISA kit

E02P0818-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Protein N terminal asparagine amidohydrolase(NTAN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Protein N terminal asparagine amidohydrolase(NTAN1) ELISA kit

E03P0818-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Protein N terminal asparagine amidohydrolase(NTAN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Protein N terminal asparagine amidohydrolase(NTAN1) ELISA kit

E03P0818-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Protein N terminal asparagine amidohydrolase(NTAN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Protein N terminal asparagine amidohydrolase(NTAN1) ELISA kit

E03P0818-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Protein N terminal asparagine amidohydrolase(NTAN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Protein N terminal asparagine amidohydrolase(NTAN1) ELISA kit

E04P0818-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Protein N terminal asparagine amidohydrolase(NTAN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Protein N terminal asparagine amidohydrolase(NTAN1) ELISA kit

E04P0818-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Protein N terminal asparagine amidohydrolase(NTAN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Protein N terminal asparagine amidohydrolase(NTAN1) ELISA kit

E04P0818-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Protein N terminal asparagine amidohydrolase(NTAN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Protein N terminal asparagine amidohydrolase(NTAN1) ELISA kit

E06P0818-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Protein N terminal asparagine amidohydrolase(NTAN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Protein N terminal asparagine amidohydrolase(NTAN1) ELISA kit

E06P0818-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Protein N terminal asparagine amidohydrolase(NTAN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Protein N terminal asparagine amidohydrolase(NTAN1) ELISA kit

E06P0818-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Protein N terminal asparagine amidohydrolase(NTAN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Protein N terminal asparagine amidohydrolase(NTAN1) ELISA kit

E07P0818-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Protein N terminal asparagine amidohydrolase(NTAN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Protein N terminal asparagine amidohydrolase(NTAN1) ELISA kit

E07P0818-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Protein N terminal asparagine amidohydrolase(NTAN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Protein N terminal asparagine amidohydrolase(NTAN1) ELISA kit

E07P0818-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Protein N terminal asparagine amidohydrolase(NTAN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Protein N terminal asparagine amidohydrolase(NTAN1) ELISA kit

E08P0818-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Protein N terminal asparagine amidohydrolase(NTAN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Protein N terminal asparagine amidohydrolase(NTAN1) ELISA kit

E08P0818-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Protein N terminal asparagine amidohydrolase(NTAN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Protein N terminal asparagine amidohydrolase(NTAN1) ELISA kit

E08P0818-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Protein N terminal asparagine amidohydrolase(NTAN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Protein N terminal asparagine amidohydrolase(NTAN1) ELISA kit

E09P0818-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Protein N terminal asparagine amidohydrolase(NTAN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Protein N terminal asparagine amidohydrolase(NTAN1) ELISA kit

E09P0818-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Protein N terminal asparagine amidohydrolase(NTAN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Protein N terminal asparagine amidohydrolase(NTAN1) ELISA kit

E09P0818-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Protein N terminal asparagine amidohydrolase(NTAN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Protein N-terminal glutamine amidohydrolase (WDYHV1) ELISA Kit

abx390862-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Protein N-terminal glutamine amidohydrolase (WDYHV1) ELISA Kit

abx392118-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

ASAH2 Protein Vector (Human) (pPB-N-His)

PV049014 500 ng
EUR 481

Human ASAH2 (Neutral ceramidase) ELISA Kit (CUSTOM)

ELI-34330h 96 Tests
EUR 824

ASAH2 siRNA

20-abx900469
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ASAH2 siRNA

20-abx908269
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ASAH2 siRNA

20-abx908270
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ASAH2 Antibody

36240-100ul 100ul
EUR 252

ASAH2 Antibody

3828-100
EUR 316

ASAH2 Antibody

3828-30T
EUR 146

ASAH2 Antibody

24731-100ul 100ul
EUR 390

ASAH2 antibody

70R-12124 100 ug
EUR 403
Description: Rabbit polyclonal ASAH2 antibody

ASAH2 Antibody

1-CSB-PA002170EA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ASAH2. Recognizes ASAH2 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:100-1:500, IF:1:50-1:500

ASAH2 Antibody

1-CSB-PA133826
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ASAH2. Recognizes ASAH2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

ASAH2 Antibody

1-CSB-PA076840
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ASAH2. Recognizes ASAH2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

Mouse Protein N- terminal asparagine amidohydrolase, Ntan1 ELISA

ELI-22414m 96 Tests
EUR 865

Guinea pig Protein N terminal asparagine amidohydrolase(NTAN1) ELISA kit

E05P0818-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Protein N terminal asparagine amidohydrolase(NTAN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Protein N terminal asparagine amidohydrolase(NTAN1) ELISA kit

E05P0818-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Protein N terminal asparagine amidohydrolase(NTAN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Protein N terminal asparagine amidohydrolase(NTAN1) ELISA kit

E05P0818-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Protein N terminal asparagine amidohydrolase(NTAN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Recombinant Human Protein N-terminal Glutamine Amidohydrolase/NTAQ1

CK09-10ug 10ug
EUR 156
Description: Supplied as a 0.2 μm filtered solution of PBS,100mM GSH,1% TritonX-100,15% glycerol,pH7.4.

Recombinant Human Protein N-terminal Glutamine Amidohydrolase/NTAQ1

CK09-1mg 1mg
EUR 2283
Description: Supplied as a 0.2 μm filtered solution of PBS,100mM GSH,1% TritonX-100,15% glycerol,pH7.4.

Recombinant Human Protein N-terminal Glutamine Amidohydrolase/NTAQ1

CK09-500ug 500ug
EUR 1613
Description: Supplied as a 0.2 μm filtered solution of PBS,100mM GSH,1% TritonX-100,15% glycerol,pH7.4.

Recombinant Human Protein N-terminal Glutamine Amidohydrolase/NTAQ1

CK09-50ug 50ug
EUR 369
Description: Supplied as a 0.2 μm filtered solution of PBS,100mM GSH,1% TritonX-100,15% glycerol,pH7.4.

ASAH2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0130503 1.0 ug DNA
EUR 154

Human ASAH2 shRNA Plasmid

20-abx961153
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ASAH2 Recombinant Protein (Human)

RP036760 100 ug Ask for price

AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS

AP-STR-KIT-2 1/pk
EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Protein N-Terminal Asparagine Amidohydrolase (NTAN1) Antibody

abx122137-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Protein N-Terminal Glutamine Amidohydrolase (WDYHV1) Antibody

abx036296-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Protein N-Terminal Asparagine Amidohydrolase (NTAN1) Antibody

abx029762-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Protein N-Terminal Asparagine Amidohydrolase (NTAN1) Antibody

abx029762-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Protein N-Terminal Glutamine Amidohydrolase (WDYHV1) Antibody

20-abx318315
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ASAH2 Protein Vector (Rat) (pPB-N-His)

PV254815 500 ng
EUR 1166

ASAH2 Protein Vector (Mouse) (pPB-N-His)

PV156551 500 ng
EUR 1065

Mouse ASAH2 (Neutral ceramidase) ELISA Kit (CUSTOM)

ELI-34287m 96 Tests
EUR 865

Rat ASAH2 (Neutral ceramidase) ELISA Kit (CUSTOM)

ELI-48960r 96 Tests
EUR 886

ASAH2 Protein Vector (Human) (pPM-N-D-C-HA)

PV324140 500 ng
EUR 481

ASAH2 Protein Vector (Human) (pPM-N-D-C-His)

PV324141 500 ng
EUR 481

Polyclonal ASAH2 Antibody

APG02010G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ASAH2 . This antibody is tested and proven to work in the following applications:

Polyclonal ASAH2 Antibody

APG02011G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ASAH2 . This antibody is tested and proven to work in the following applications:

ASAH2 Conjugated Antibody

C36240 100ul
EUR 397

ASAH2 Rabbit pAb

A12596-100ul 100 ul
EUR 308

ASAH2 Rabbit pAb

A12596-200ul 200 ul
EUR 459

ASAH2 Rabbit pAb

A12596-20ul 20 ul
EUR 183

ASAH2 Rabbit pAb

A12596-50ul 50 ul
EUR 223

ASAH2 Polyclonal Antibody

A62106 100 µg
EUR 570.55
Description: fast delivery possible

ASAH2 Rabbit pAb

A7985-100ul 100 ul
EUR 308

ASAH2 Rabbit pAb

A7985-200ul 200 ul
EUR 459

ASAH2 Rabbit pAb

A7985-20ul 20 ul
EUR 183

ASAH2 Rabbit pAb

A7985-50ul 50 ul
EUR 223

ASAH2 Blocking Peptide

33R-10941 50 ug
EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ASAH2 antibody, catalog no. 70R-12124

ASAH2 Blocking Peptide

3828BP-50
EUR 153

ASAH2 cloning plasmid

CSB-CL865115HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2181
  • Sequence: ATGAGTGCCATCACAGTGGCCCTTCTCAGCCTCTTGTTTATCACCAGTGGGACCATTGAAAACCACAAAGATTTAGGAGGCCATTTTTTTTCAACCACCCAAAGCCCTCCAGCCACCCAGGGCTCCACAGCCGCCCAACGCTCCACAGCCACCCAGCATTCCACAGCCACCCAGA
  • Show more
Description: A cloning plasmid for the ASAH2 gene.

Anti-ASAH2 antibody

STJ110292 100 µl
EUR 277

Anti-ASAH2 antibody

STJ114470 100 µl
EUR 277

ASAH2 ORF Vector (Human) (pORF)

ORF012254 1.0 ug DNA
EUR 354

Porcine Protein N- terminal asparagine amidohydrolase, NTAN1 ELI

ELI-36835p 96 Tests
EUR 928

Protein N-Terminal Glutamine Amidohydrolase (WDYHV1) Antibody (HRP)

20-abx310044
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Protein N-Terminal Glutamine Amidohydrolase (WDYHV1) Antibody (FITC)

20-abx310045
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Protein N-Terminal Glutamine Amidohydrolase (WDYHV1) Antibody (Biotin)

20-abx310046
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Recombinant Human N-Acyl-Aromatic-L-Amino Acid Amidohydrolase/ACY3 (N-6His)

CH99-10ug 10ug
EUR 156
Description: Supplied as a 0.2 μm filtered solution of 20mM Tris,100mM NaCl,1mM DTT,10%Glycerol,pH 8.0.

Recombinant Human N-Acyl-Aromatic-L-Amino Acid Amidohydrolase/ACY3 (N-6His)

CH99-1mg 1mg
EUR 2283
Description: Supplied as a 0.2 μm filtered solution of 20mM Tris,100mM NaCl,1mM DTT,10%Glycerol,pH 8.0.

Recombinant Human N-Acyl-Aromatic-L-Amino Acid Amidohydrolase/ACY3 (N-6His)

CH99-500ug 500ug
EUR 1613
Description: Supplied as a 0.2 μm filtered solution of 20mM Tris,100mM NaCl,1mM DTT,10%Glycerol,pH 8.0.

Recombinant Human N-Acyl-Aromatic-L-Amino Acid Amidohydrolase/ACY3 (N-6His)

CH99-50ug 50ug
EUR 369
Description: Supplied as a 0.2 μm filtered solution of 20mM Tris,100mM NaCl,1mM DTT,10%Glycerol,pH 8.0.

Asah2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3499603 1.0 ug DNA
EUR 154

Asah2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7087003 1.0 ug DNA
EUR 154

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Mouse ASAH2 shRNA Plasmid

20-abx974501
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat ASAH2 shRNA Plasmid

20-abx987160
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ASAH2 Antibody, HRP conjugated

1-CSB-PA002170EB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ASAH2. Recognizes ASAH2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ASAH2 Antibody, FITC conjugated

1-CSB-PA002170EC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ASAH2. Recognizes ASAH2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ASAH2 Antibody, Biotin conjugated

1-CSB-PA002170ED01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ASAH2. Recognizes ASAH2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

ASAH2 Recombinant Protein (Rat)

RP191108 100 ug Ask for price

ASAH2 Recombinant Protein (Mouse)

RP117410 100 ug Ask for price

Acylsphingosine Deacylase 3 (ASAH3) Antibody

20-abx147917
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Human Plasma high density lipoprotein (HDL) native, purified

HDLD31-N-2 2 mg
EUR 408

ASAH2 sgRNA CRISPR Lentivector set (Human)

K0130501 3 x 1.0 ug
EUR 339

Human Plasma low density lipoprotein (dil-LDL) Dil-labeled, purified

LDLD15-N-2 200 ug
EUR 590

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

N-Acetylglucosamine

NAG15-N 1 g
EUR 286

Purified Human beta-2 microglobulin (B2M) protein for ELISA/Standards

B2M15-N 50 ug
EUR 286

Haptoglobin 2-2 (Hp2-2), Human Plasma (>95%, 170-900 kda)

HGLB21-N 0.5 mg
EUR 286

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

Coelenterazine n

10115-2 250uG
EUR 259
Description: Minimum order quantity: 1 unit of 250uG

ASAH2 Polyclonal Antibody, HRP Conjugated

A62107 100 µg
EUR 570.55
Description: reagents widely cited

ASAH2 Polyclonal Antibody, FITC Conjugated

A62108 100 µg
EUR 570.55
Description: Ask the seller for details

ASAH2 Polyclonal Antibody, Biotin Conjugated

A62109 100 µg
EUR 570.55
Description: The best epigenetics products

Pseudomonas putida Creatinine amidohydrolase (crnA)

1-CSB-EP028075FFZ
  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 55.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Pseudomonas putida Creatinine amidohydrolase(crnA) expressed in E.coli

Asah2 ORF Vector (Mouse) (pORF)

ORF039138 1.0 ug DNA
EUR 506

Asah2 ORF Vector (Rat) (pORF)

ORF063704 1.0 ug DNA
EUR 506

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV100PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV105PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV120PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV125PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Acylsphingosine Deacylase 3-Like (ASAH3L) Antibody

20-abx014172
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Human Fibrinogen (FBG) AssayMax ELISA Kit

EF1040-2 96 Well Plate
EUR 396

ASAH2 sgRNA CRISPR Lentivector (Human) (Target 1)

K0130502 1.0 ug DNA
EUR 154

ASAH2 sgRNA CRISPR Lentivector (Human) (Target 3)

K0130504 1.0 ug DNA
EUR 154

Human ASAH2(N-Acylsphingosine Amidohydrolase 2) ELISA Kit